groupReport-commaMotifEnrichmentResults-method: Generate a motif enrichment report for the whole group of...

Description Arguments Value Examples

Description

Generate a motif enrichment report for the whole group of sequences together

Arguments

obj

a MotifEnrichmentResults object

top

what proportion of top motifs should be examined in each individual sequence (by default 5%)

bg

if to use background corrected P-values to do the ranking (if available)

by.top.motifs

if to rank by the proportion of sequences where the motif is within 'top' percentage of motifs

...

unused

Value

a MotifEnrichmentReport object containing a table with the following columns:

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
if(require("PWMEnrich.Dmelanogaster.background")){
   ###
   # load the pre-compiled lognormal background
   data(PWMLogn.dm3.MotifDb.Dmel)

   # scan two sequences for motif enrichment
   sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

   res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

   # produce a report for all sequences taken together
   r.default = groupReport(res)

   # produce a report where the last column takes top 1\% motifs
   r = groupReport(res, top=0.01)

   # view the results
   r

   # plot the top 10 most enriched motifs
   plot(r[1:10])

}

PWMEnrich documentation built on Nov. 1, 2018, 2:25 a.m.