plot: Plotting for the PWM class

Description Arguments Examples

Description

This function produces a sequence logo (via package seqLogo).

Plots a graphical version of the motif enrichment report. Note that all values are plotted, if you want to plot only a subset of a report, first select this subset (see examples).

Arguments

x

the PWM object

y

unused

...

other parameters to pass to seqLogo's plot function

x

a MotifEnrichmentReport object

y

unused

fontsize

font size to use in the plot

header.fontsize

font size of the header

widths

the relative widths of columns

...

unused if(require("PWMEnrich.Dmelanogaster.background")) ### # load the pre-compiled lognormal background data(PWMLogn.dm3.MotifDb.Dmel)

# scan two sequences for motif enrichment sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

# produce a report for all sequences taken together r = groupReport(res)

# plot the top 10 most enriched motifs plot(r[1:10])

Examples

1
2
3
4
5
6
if(require("PWMEnrich.Dmelanogaster.background")){
  data(MotifDb.Dmel)

  # plot the tinman motif from MotifDb
  plot(MotifDb.Dmel[["tin"]])
}

Example output

Loading required package: grid
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colMeans, colSums, colnames, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
    pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
    setdiff, sort, table, tapply, union, unique, unsplit, which,
    which.max, which.min

Loading required package: Biostrings
Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

Loading required package: PWMEnrich.Dmelanogaster.background
Warning message:
In library(package, lib.loc = lib.loc, character.only = TRUE, logical.return = TRUE,  :
  there is no package called 'PWMEnrich.Dmelanogaster.background'

PWMEnrich documentation built on Nov. 1, 2018, 2:25 a.m.