sequenceReport-commaMotifEnrichmentResults-method: Generate a motif enrichment report for a single sequence

Description Arguments Value Examples

Description

Generate a motif enrichment report for a single sequence

Arguments

obj

a MotifEnrichmentResults object

seq.id

the sequence index or name

bg

if to use background corrected P-values to do the ranking (if available)

...

unused

Value

a MotifEnrichmentReport object containing a table with the following columns:

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
if(require("PWMEnrich.Dmelanogaster.background")){
   ###
   # load the pre-compiled lognormal background
   data(PWMLogn.dm3.MotifDb.Dmel)

   # scan two sequences for motif enrichment
   sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

   res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

   # reports for the two sequences
   r1 = sequenceReport(res, 1)
   r2 = sequenceReport(res, 2)

   # view the results
   r1
   r2

   # plot the top 10 most enriched motifs in the first, and then second sequence
   plot(r1[1:10])
   plot(r2[1:10])

}

PWMEnrich documentation built on Nov. 1, 2018, 2:25 a.m.