R/str.R

In gquad: Prediction of G Quadruplexes and Other Non-B DNA Motifs

str_base <- function(a){
  # replace spaces with nothing
  aSpace <- gsub("-", "", a)
  a <- aSpace
  if(nchar(a) < 12) return(data.frame("sequence_position" = "-", "sequence" = "-", "sequence_length" = "-"))


  # main strand

  a4 <- "([ACGTURYSWKMBDHVN]{2,7})\\1{5,99}"
  a5 <- gregexpr(a4, a, ignore.case = TRUE, perl = T)
  sequence_position <- a5[[1]][1:length(a5[[1]])]
  if(a5[[1]][1] == -1){
    resultClean5 <- data.frame("sequence_position" = "-", "sequence" = "-", "sequence_length" = "-")
  }else{
    a8 <- regmatches(a, a5)
    sequence <- a8[[1]][1:length(a8[[1]])]
    sequence_length <- nchar(sequence)
    a10 <- cbind(sequence_position, sequence, sequence_length)
    resultClean4 <- data.frame(a10)
    if(length(resultClean4[,1]) == 0){
      resultClean5 <- data.frame("sequence_position" = "-", "sequence" = "-", "sequence_length" = "-")
    }else{
      resultClean5 <- resultClean4
    }
  }
  return(resultClean5)
}

str_main <- function(b){
  if(length(b) == 1){
    #remove newlines
    b <- gsub("[\r\n]", "", b)
    b <- gsub(" ", "", b)
    # exit if unacceptable characters exist
    if(grepl("[^acgturyswkmbdhvnACGTURYSWKMBDHVN-]", b) == "TRUE"){
      b1 <- data.frame("sequence_position" = "!", "sequence" = "Error: Non-nucleotide character(s) in input", "sequence_length" = "!")
      return(b1)
    }else{
      # else continue
      b1 <- str_base(b)
      return(b1)
    }

  }else{
    # exit if unacceptable characters exist
    input_pos = 0
    q <- data.frame("input_ID" = integer(0), "sequence_position" = character(0), "sequence" = character(0), "sequence_length" = character(0))
    for(i in b){
      #remove newlines
      b <- gsub("[\r\n]", "", i)
      b <- gsub(" ", "", i)
      # exit if unacceptable characters exist
      if(grepl("[^acgturyswkmbdhvnACGTURYSWKMBDHVN-]", i) == "TRUE"){
        b1 <- data.frame("sequence_position" = "!", "sequence" = "Error: Non-nucleotide character(s) in input", "sequence_length" = "!")
      }else{
        b1 <- str_base(i)
      }
      input_pos = input_pos + 1
      b2 <- cbind(input_ID = input_pos, b1)
      b2[,c(2,4)] <- sapply(b2[,c(2,4)],as.character)
      q <- rbind(q, b2)
    }
    return(q)
  }
}




#' Predicting short tandem repeats
#'
#' This function predicts short tandem repeats
#' in 'x' in nucleotides. Nucleotide sequence can be provided in raw or fasta format or as GenBank accession number(s).
#' Internet is needed to connect to GenBank database, if accession number(s) is given as argument.
#'
#' @param x Nucleotide sequence(s) in raw format or a fasta file or a GenBank accession number(s); from which short tandem repeats will be predicted.
#'  If the fasta file name does not contain an absolute path, the file name is relative to the current working directory.
#' @param xformat a character string specifying the format of x : default (raw), fasta, GenBank (GenBank accession number(s)).
#' @return A dataframe of short tandem repeats' position, sequence and length. If more than one DNA sequence is provided as argument, an input ID is returned for repeats predicted from each input sequence.
#' @author Hannah O. Ajoge
#' @details
#' This function predicts short tandem repeats in nucleotide sequences and provide the position, sequence and length of the predicted repeats, if any.
#' @export
#' @importFrom ape read.GenBank
#' @importFrom seqinr read.fasta
#' @importFrom seqinr getSequence
#' @references Paper on gquad and the web application (Non-B DNA Predictor) is under review, see draft in vignettes
#' @examples
#'  ## Predicting short tandem repeats from raw nucleotide sequences
#' E1 <- c("TCTACACACACACACACACACGAAT", "tagggugugugugugugugugugutcct")
#' str(E1)
#'
#' ## Predicting short tandem repeats from nucleotide sequences in fasta file
#' ## Not run: str(x="Example.fasta", xformat = "fasta")
#'
#' ## Predicting short tandem repeats from nucleotide sequences,
#' ## using GenBank accession numbers.
#' ## Internet connectivity is needed for this to work.
#' ## Not run: str(c("BH114913", "AY611035"), xformat = "GenBank")



str <- function(x, xformat = "default"){
  if(xformat == "default"){
    x1 <- str_main(x)
    return(x1)
  }

  if(xformat == "GenBank"){
    x2 <- read.GenBank(x, as.character = TRUE)
    x3 <- sapply(x2, paste, collapse="")
    x4 <- str_main(x3)
    return(x4)
  }

  if(xformat == "fasta"){
    x5 <-read.fasta(x)
    x6 <- getSequence(x5, as.string = TRUE)
    x7 <- unlist(x6)
    x8 <- str_main(x7)
    return(x8)
  }else{
    stop("Unacceptable option for argument 'xformat'")
  }

}