Nothing
#' The Trinucleotide-based Auto-cross Covariance Descriptor
#'
#' The Trinucleotide-based Auto-cross Covariance Descriptor
#'
#' This function calculates the trinucleotide-based auto-cross covariance descriptor
#'
#' @param x the input data, which should be a list or file type.
#'
#' @param index the physicochemical indices, it should be a list and there are 12
#' different physicochemical indices (Table 2), which the users can choose.
#'
#' @param nlag an integer larger than or equal to 0 and less than or equal to L-2 (L means the length
#' of the shortest DNA sequence in the dataset). It represents the distance between two dinucleotides.
#'
#' @param normaliztion with this option, the final feature vector will be normalized based
#' on the total occurrences of all kmers. Therefore, the elements in the feature vectors
#' represent the frequencies of kmers. The default value of this parameter is False.
#'
#' @param allprop all the 12 physicochemical indices will be
#' employed to generate the feature vector. Its default value is False.
#'
#' @param customprops the users can use their own indices to generate the feature vector. It should be a dict,
#' the key is dinucleotide (string), and its corresponding value is a list type.
#'
#' @return A vector
#'
#' @keywords extract TACC
#'
#' @aliases extrTACC
#'
#' @author Min-feng Zhu <\email{wind2zhu@@163.com}>
#'
#' @export extrTACC
#'
#' @seealso See \code{\link{extrTAC}} and \code{\link{extrTCC}}
#'
#' @note if the user defined physicochemical indices have not been normalized, it should be normalized.
#'
#' @examples
#'
#' x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
#' extrTACC(x)
#'
extrTACC = function (x, index = c('Dnase I', 'Nucleosome'), nlag = 2, normaliztion = FALSE,
customprops = NULL, allprop = FALSE) {
tac = extrTAC(x, index, nlag, customprops = customprops,
allprop = allprop, normaliztion = normaliztion)
tcc = extrTCC(x, index, nlag, customprops = customprops,
normaliztion = normaliztion)
tacc = c(tac, tcc)
return(tacc)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.