Provides an R interface to the Registry of Standard Biological Parts API maintained by the iGEM Foundation. Facilitates retrieval of the part number, authorship, date of entry, url, short description, type, and sequence following the Registry guidelines. All Registry content falls under Creative Commons Attribution-ShareAlike.
Users can enter the name of a part and will receive a tibble containing information about that part. Multiple parts can be accessed simultaneously using other R functions to apply getPart() over a vector containing the part names. Examples for single-part and multiple-part retrieval are provided below. The provided multi-part retrieval example requires the use of the map_df function from the purrr library.
Install the released version of rsbp from CRAN with:
install.packages("rsbp")
#> Error in install.packages : Updating loaded packages
Load the package with:
library(rsbp)
For retrieval of information for single parts:
#retrieve and store information for a single part
result<-getPart("BBa_R0040")
#examine info
head(result)
#> # A tibble: 1 x 10
#> id name shortName seq type results url entered desc author
#> <dbl> <chr> <chr> <chr> <chr> <chr> <chr> <date> <chr> <chr>
#> 1 187 BBa_R0~ R0040 tccctatcagtgatagagattg~ Regula~ Works http://parts.i~ 2003-01-31 TetR repres~ " June Rhee, Connie ~
For retrieval of information for multiple parts:
#load purrr to get map_df()
library(purrr)
#define vector of part names
parts<-c("BBa_B0034","BBa_B0035","BBa_B0036")
#apply function to each input with map_df
result<-map_df(parts, getPart)
#examine info
head(result)
#> # A tibble: 3 x 10
#> id name shortName seq type results url entered desc author
#> <dbl> <chr> <chr> <chr> <chr> <chr> <chr> <date> <chr> <chr>
#> 1 151 BBa_B0~ B0034 aaagagg~ RBS Works http://parts~ 2003-01-31 RBS (Elowitz 19~ "Vinay S Mahajan, Voichita D. Marin~
#> 2 3978 BBa_B0~ B0035 attaaag~ RBS Works http://parts~ 2004-01-27 RBS (B0030 deri~ "Jason Kelly"
#> 3 4699 BBa_B0~ B0036 gtgtg RBS None http://parts~ 2004-06-08 Specialized RBS "Barry Canton"
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.