R/ScaledChiSquare.R

In fredysiegrist/statanacoseq: Statistical Analyses of Codon Usage in Custom Genome Sequences

#' @title Scaled Chi-Square
#'
#' @description
#' \code{ScaledChiSquare} Computes the Scaled Chi-Square Index for a Gene
#'
#' @details
#' Should be implemented because missing in Darwin
#'
#' @param cds Coding Sequence
#' @return VOID
#'
#' @author Siegrist, F. and Cannarozzi, G. M. \email{gina@@cannarozzi.com}
#' @seealso \code{\link{seqinr}} \code{\link{statanacoseq}}
#' @keywords CodonBias
#' @examples
#' ScaledChiSquare('ATGTGGTACTCCGACTACGGAGGATAA')
#' ScaledChiSquare(c2s(mylist(whatout=1)[[1]]))
#'
#' @import seqinr
#'
#' @export
#' @section Original code in Darwin:
#' \subsection{Scaled Chi-Square.}{\preformatted{
#' ScaledChiSquare := proc(d:string)
#' # to be implemented
#' end: } }

  ScaledChiSquare <- function(cds) {
  # to be implemented
}