This is an R package that implements the Needleman and Wunsch sequence alignment, unit tested using the testthat unit testing framework.
To install:
* using devtools: devtools::install_github("hiraethus/Needleman-Wunsch")
Example usage:
> library("hiraethus.needleman.wunsch")
> sequence1 <- "ACCCGGTCGTCAATTA"
> sequence2 <- "ACCACCGGTTGGTCCAATAA"
# scoring scheme for the algorithm
> match <- 1
> mismatch <- -1
> gap <- -1
> alignment <- needle(sequence1, sequence2, gap, match, mismatch)
> print(alignment)
Needleman-Wunsch Sequence Alignment
===================================
Alignment 1: A C C _ C _ G G T C G _ T C _ A A T T A
Alignment 2: A C C A C C G G T T G G T C C A A T A A
Max score : 7
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.