knitr::opts_chunk$set( collapse = TRUE, comment = "#>" )
library(centraldogma)
The centraldogma package replicates the central dogma of molecular biology. More specifically it replicates the flow of genetic information from DNA to RNA to protein.
The package consists of the following five functions, which are demonstrated
below: generate_dna
, transcribe
, split_codons
, translate
and
plot_aa_occurrence
.
The generate_dna
is used to generate a random DNA sequence. The length
argument controls the length of the generated sequence:
set.seed(6942069) generate_dna(length = 20)
The transcribe()
function transcribes a DNA sequence into a RNA sequence by
replacing Thymine (T) with Uracil (U):
dna_fragment <- "CCATGTTATG" transcribe(dna_fragment)
The split_codons
function splits a RNA sequence into codons. The start
argument specifies the start position of the reading frame. The position can be
any position in the RNA sequence with a default value of one:
rna_fragment <- "AUCGUACGAUAUGAUACAGAGAUAGACAUAUUUAACGG" split_codons(rna_fragment, start = 5)
The translate
function translates a sequence of RNA codons into a protein
sequence by replacing codons into the amino acids they code for using a standard
codon table. Stop codons are translated to "_". The codon table can be accessed
with the function codon_table
.
Here is an example of the use of the translate
function:
rna_codon_sequence <- c("GGG", "GGC", "GCG", "UCC", "GUC") translate(rna_codon_sequence)
The plot_aa_occurrence
function makes a plot of the occurrence of each amino
acid in a protein sequence:
protein_sequence <- "GGASVTVSRFW_PSQSKQRHRVEPVS_IQSYLP" plot_aa_occurrence(protein_sequence)
The five functions included in centraldogma
can be used in a pipeline as
follows:
dna_sequence <- generate_dna(length = 250) rna_sequence <- transcribe(dna_sequence) rna_codon_sequence <- split_codons(rna_sequence) protein_sequence <- translate(rna_codon_sequence) plot_aa_occurrence(protein_sequence)
centraldogma
can e.g. be used to translate DNA sequences into protein
sequences by running the full pipeline of functions as shown under example
workflow. Alternatively one could start with RNA sequences instead and do the
translation or start with a protein sequence and make an occurrence plot.
Some other functions that could be implemented in the package could be:
Also it would be nice if the translate
function could use other codon tables
than the standard one.
The number of dependencies should be limited such that the user does not have to install a bunch of packages. It cannot be avoided if the R base package does not include the functionality that you want and you do not wish to implement it yourself.
Adding an @importFrom package function
tag to a function description
has a small performance benefit compared to package::function()
due to ::
adding approximately 5 µs to function evaluation time. However, it is more clear
what package a function belongs to with ::
. Also, @importFrom
might cause
name conflicts if another function with the same name already exists in the
namespace.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.