The goal of codonr is to ...
You can install the released version of codonr from GitHub with:
devtools::install_github("santiago1234/codonr")
This is a basic example which shows you how to solve a common problem:
library(codonr)
dna_seq <- "ATGACAGAGGGGGGACAGTTAATG"
count_codons(dna_seq)
#> # A tibble: 7 x 2
#> codon n
#> <chr> <int>
#> 1 ACA 1
#> 2 ATG 2
#> 3 CAG 1
#> 4 GAG 1
#> 5 GGA 1
#> 6 GGG 1
#> 7 TTA 1
Project specific code
the pattern project_id.*.R
indicates that all the files are part of a specific code project.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.