#' Virtual PCR.
#'
#' \code{virtualPCR} queries a list of DNA sequences with virtual primers
#' (either sequences or profile hidden Markov models) and returns only
#' the sequences that contain regions of sufficient similarity based on
#' log-odds alignment scoring.
#'
#' @param x a list of DNA sequences in \code{DNAbin} format.
#' @param up an object of class \code{DNAbin} or \code{PHMM} giving the
#' forward primer with which to query the sequence list.
#' @param down an optional argument the same type as \code{up} giving the
#' reverse primer with which to query the sequence list. If NULL only
#' the forward primer is used.
#' @param rcdown logical indicating whether the reverse primer should be
#' reverse-complemented prior to aligning with the input sequences. Set
#' to TRUE only if \code{down} is not NULL, is of class \code{DNAbin}, and
#' is the reverse complement of the target sequence (e.g. the sequence of
#' a reverse primer as would be ordered from an oligo supplier).
#' @param trimprimers logical indicating whether the primer-binding sites
#' should be removed from the sequences in the returned list.
#' @param minfsc numeric, giving the minimum specificity(log-odds score
#' for the optimal alignment) between the forward primer and a sequence
#' for that sequence to be retained.
#' @param minrsc numeric, the minimum specificity (log-odds score for
#' the optimal alignment) between the reverse primer (if provided) and
#' a sequence for that sequence to be retained.
#' @param minamplen,maxamplen integers giving the minimum and maximum
#' acceptable amplicon lengths. Sequences are discarded if the number
#' of base pairs between the primer-binding sites falls outside of these
#' limits.
#' @param maxNs numeric giving the maximum acceptable proportion
#' of the ambiguous residue "N" within the output sequences.
#' Defaults to 0.02.
#' @param partialbind logical indicating whether partial primer matching is
#' accepted. Defaults to TRUE.
#' @param cores integer giving the number of processors for multithreading.
#' Defaults to 1, and reverts to 1 if x is not a list.
#' This argument may alternatively be a 'cluster' object,
#' in which case it is the user's responsibility to close the socket
#' connection at the conclusion of the operation,
#' for example by running \code{parallel::stopCluster(cores)}.
#' The string 'autodetect' is also accepted, in which case the maximum
#' number of cores to use is one less than the total number of cores available.
#' Note that in this case there
#' may be a tradeoff in terms of speed depending on the number and size
#' of sequences to be processed, due to the extra time required to initialize
#' the cluster.
#' @param quiet logical indicating whether progress should be printed to
#' the console.
#' @return a list of trimmed sequences, an object of class
#' \code{DNAbin}.
#' @author Shaun Wilkinson
#' @examples
#' ## trim whale sequences using a new set of inner primers
#' inner_for <- "CGGTTGGGGTGACCTCGGAGTA"
#' inner_rev <- "GCTGTTATCCCTAGGGTAA"
#' whales_short <- virtualPCR(whales, up = inner_for, down = inner_rev,
#' trimprimers = TRUE)
################################################################################
virtualPCR <- function(x, up, down = NULL, rcdown = TRUE, trimprimers = FALSE,
minfsc = 50, minrsc = 50, minamplen = 50,
maxamplen = 2000, maxNs = 0.02, partialbind = TRUE, cores = 1,
quiet = FALSE){
ischar <- mode(x) == "character"
if(ischar) x <- char2dna(x)
xc <- dna2char(x)
if(mode(up) == "character"){
up <- char2dna(up)[[1]]
if(!is.null(down)) down <- char2dna(down)[[1]]
}
nseq <- length(x)
if(nseq == 0) stop("No sequences provided\n")
## speed up by exact trimming for long seqs
if(!is.null(down)){
upc <- dna2char(up)
dnc <- dna2char(down)
if(rcdown) dnc <- rc(dnc)
upc <- disambiguate(upc)
dnc <- disambiguate(dnc)
pattern <- paste0(".*(", upc, ".+", dnc, ").*")
xc <- sub(pattern, "\\1", xc)
x <- char2dna(xc)
}
if(!quiet) cat("Started with", nseq, "sequences\n")
if(inherits(cores, "cluster")){
para <- TRUE
stopclustr <- FALSE
}else if(cores == 1){
para <- FALSE
stopclustr <- FALSE
}else{
navailcores <- parallel::detectCores()
if(identical(cores, "autodetect")) cores <- navailcores - 1
if(cores > 1){
# if(cores > navailcores) stop("Number of cores is more than number available")
if(!quiet) cat("Multithreading with", cores, "cores\n")
cores <- parallel::makeCluster(cores)
para <- TRUE
stopclustr <- TRUE
}else{
para <- FALSE
stopclustr <- FALSE
}
}
# trim all nucleotides to left of forward primer bind site, including primer if specified
forfun <- function(s, up, trimprimers, minfsc, partialbind, minamplen){
vit <- aphid::Viterbi(up, s, type = "semiglobal", odds = TRUE)
if(vit$score >= minfsc){
pl <- length(vit$path)
if(partialbind | vit$path[1] != 0){
zeroonestarts <- match(0:1, vit$path)
zeroonestarts <- zeroonestarts[!is.na(zeroonestarts)]
overhang <- min(zeroonestarts) - 1
if(overhang > 0) s <- s[-(1:overhang)]
if(trimprimers){
zeroonestarts2 <- match(0:1, rev(vit$path))
zeroonestarts2 <- zeroonestarts2[!is.na(zeroonestarts2)]
tokeep <- min(zeroonestarts2) - 1
if(tokeep > 0) s <- rev(rev(s)[1:tokeep]) else {##################################
#cat("wtf?")
return(NULL)
}
}
if(length(s) < minamplen) return(NULL)
attr(s, "forscore") <- vit$score
return(s)
}
}
return(NULL)
}
tmpattr <- attributes(x)
whichattr <- which(sapply(tmpattr, length) == length(x))
if(!quiet) cat("Forward trimming sequences\n")
x <- if(para){
parallel::parLapply(cores, x, forfun, up, trimprimers, minfsc, partialbind, minamplen)
}else{
lapply(x, forfun, up, trimprimers, minfsc, partialbind, minamplen)
}
discards <- sapply(x, is.null)
nseq <- sum(!discards)
if(!quiet) cat("Retained", nseq, "sequences after forward trim\n")
if(nseq > 0){
forscores <- unlist(lapply(x, function(s) attr(s, "forscore")), use.names = FALSE)
x <- x[!discards]
x <- lapply(x, as.vector) # removes individual forscore attrs
for(i in whichattr) tmpattr[[i]] <- tmpattr[[i]][!discards]
attributes(x) <- tmpattr
attr(x, "forscores") <- forscores
}else{
if(!quiet) cat("None of the sequences met forward primer specificity criteria\n")
x <- NULL # cant return yet since cluster is still open
}
# trim all nucleotides to right of reverse primer bind site, including primer if specified
if(!is.null(down) & !is.null(x)){
if(rcdown) down <- ape::complement(down)
revfun <- function(s, down, trimprimers, minrsc, partialbind, minamplen, maxamplen){
vit <- aphid::Viterbi(down, s, type = "semiglobal", odds = TRUE)
if(vit$score >= minrsc){
pl <- length(vit$path)
if(partialbind | vit$path[pl] != 0){
zeroonestarts <- match(0:1, rev(vit$path))
zeroonestarts <- zeroonestarts[!is.na(zeroonestarts)]
overhang <- min(zeroonestarts) - 1
if(overhang > 0) s <- rev(rev(s)[-(1:overhang)])
if(trimprimers){
zeroonestarts2 <- match(0:1, vit$path)
zeroonestarts2 <- zeroonestarts2[!is.na(zeroonestarts2)]
tokeep <- min(zeroonestarts2) - 1
if(tokeep > 0) s <- s[1:tokeep] else {
return(NULL)}
}
if(length(s) >= minamplen & length(s) <= maxamplen) {
attr(s, "revscore") <- vit$score
return(s)
}
}
}else{
###cat("wtf?")
}
return(NULL)
}
tmpattr <- attributes(x)
whichattr <- which(sapply(tmpattr, length) == length(x))
if(!quiet) cat("Reverse trimming sequences\n")
x <- if(para){
parallel::parLapply(cores, x, revfun, down, trimprimers, minrsc, partialbind, minamplen, maxamplen)
}else{
lapply(x, revfun, down, trimprimers, minrsc, partialbind, minamplen, maxamplen)
}
discards <- sapply(x, is.null)
nseq <- sum(!discards)
if(nseq > 0){
revscores <- unlist(lapply(x, function(s) attr(s, "revscore")), use.names = FALSE)
if(!quiet) cat("Retained", nseq, "sequences after reverse trim\n")
x <- x[!discards]
x <- lapply(x, as.vector) # removes individual revscore attrs
for(i in whichattr) tmpattr[[i]] <- tmpattr[[i]][!discards]
attributes(x) <- tmpattr
attr(x, "revscores") <- revscores
}else{
if(!quiet) cat("None of the sequences met reverse primer specificity criteria\n")
x <- NULL
}
}
if(para & stopclustr) parallel::stopCluster(cores)
if(is.null(x)) return(x)
if(!quiet) cat("Filtering ambiguous sequences\n")
discards <- sapply(x, function(s) sum(s == 0xf0)/length(s)) > maxNs
x <- subset.DNAbin(x, subset = !discards)
if(!quiet) cat(length(x), "sequences retained after applying ambiguity filter\n")
if(ischar) x <- dna2char(x)
if(!quiet) cat("Done\n")
return(x)
}
################################################################################
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.