extrDNAPseDNC: The Pseudo Dinucleotide Composition Descriptor

In BioMedR: Generating Various Molecular Representations for Chemicals, Proteins, DNAs/RNAs and Their Interactions

Description

The Pseudo Dinucleotide Composition Descriptor

Usage

extrDNAPseDNC(x, lambda = 3, w = 0.05, normalize = FALSE,
  customprops = NULL)

Arguments

x	the input data, which should be a list or file type.
lambda	an integer larger than or equal to 0 and less than or equal to L-2 (L means the length of the shortest sequence in the dataset). It represents the highest counted rank (or tier) of the correlation along a DNA sequence. Its default value is 3.
w	the weight factor ranged from 0 to 1. Its default value is 0.05.
normalize	with this option, the final feature vector will be normalized based on the total occurrences of all kmers. Therefore, the elements in the feature vectors represent the frequencies of kmers. The default value of this parameter is False.
customprops	the users can use their own indices to generate the feature vector. It should be a dict, the key is dinucleotide (string), and its corresponding value is a list type.

Details

This function calculates the pseudo dinucleotide composition Descriptor

Value

A vector

Note

if the user defined physicochemical indices have not been normalized, it should be normalized.

Author(s)

Min-feng Zhu <[e-mail]>

References

Chen W, Feng P M, Lin H, et al. iRSpot-PseDNC: identify recombination spots with pseudo dinucleotide composition. Nucleic acids research, 2013: gks1450.

See Also

See extrDNAPseKNC

Examples

x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrDNAPseDNC(x)

BioMedR documentation built on Nov. 17, 2017, 10:08 a.m.