Nothing
Computation of melting temperature of nucleic acid duplexes with `rmelting`
In rmelting: R Interface to MELTING 5
out_type <- knitr::opts_knit$get("rmarkdown.pandoc.to")
r = getOption("repos")
r["CRAN"] = "https://cran.rstudio.com/"
#r["CRAN"] = "https://cloud.r-project.org/"
#r["CRAN"] = "https://ftp.iitm.ac.in/cran/"
options(repos = r)
switch(out_type,
html = {cat("<p>1. Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi.</p>
<p>2. Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi.</p>")},
latex = cat("\\begin{center}
1. Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi.
2. Division of Crop Physiology, ICAR-Indian Agricultural Research Institute, New Delhi.
\\end{center}" )
)
\begin{center}
\vspace{6pt}
\hrule
\end{center}
knitr::opts_chunk$set(echo = TRUE)
library(readxl)
# x <- read_excel("vignettes/Tables.xlsx", sheet = "Approx.methods", col_names = TRUE)
rmeltingtables <- function(file, sheet, def="default",
code="Formula", ref = "Reference") {
if (requireNamespace("readxl", quietly = TRUE)) {
x <- read_excel(path = file, sheet = sheet, col_names = TRUE)
x[,code] <- paste0("`", unlist(x[,code]), "`", sep = "")
if (!is.null(def)) {
ind <- which(is.na(x[,def]) %in% FALSE)
x[ind,code] <- paste0(unlist(x[ind,code]), unlist(x[ind,def]), sep = "")
rm(ind)
}
x[, def] <- NULL
x[, ref] <- gsub("\\[|\\]", "", unlist(x[, ref]))
x[, ref] <- gsub(";", ",", unlist(x[, ref]))
x[, "Limits/Remarks"] <- gsub("(\\\\code\\{)(.+)(\\})", "`\\2`", unlist(x[, "Limits/Remarks"]))
# x <- data.frame(x)
pander::pander(x, style = 'multiline',
split.cell = c(13, 10, 20, 20),
justify = c('left'), split.table = Inf, keep.line.breaks = FALSE,
use.hyphening = FALSE, missing = "")
} else {
print("Package 'readxl' is required to generate this table.")
}
}
\tableofcontents
\begin{wrapfigure}{r}{0.35\textwidth}
\vspace{-10pt}
\begin{center}
\includegraphics[width=0.33\textwidth]{r system.file("extdata", "rmelting.png", package = "rmelting")}
\end{center}
\vspace{-10pt}
\end{wrapfigure}
Introduction
The R package rmelting is an interface to the MELTING 5 program [@le_novere_melting_2001; @dumousseau_melting_2012] to compute melting temperatures of nucleic acid duplexes (DNA/DNA, DNA/RNA, RNA/RNA or 2'-O-MeRNA/RNA) along with other thermodynamic parameters such as hybridisation enthalpy and entropy.
Melting temperatures are computed by Nearest-neighbour methods for short sequences or approximative estimation formulae for long sequences. Apart from these, multiple corrections are available to take into account the presence of Cations (Na, Tris, K and Mg) or denaturing agents (DMSO and formamide).
Installation
The package can be installed from Bioconductor as follows.
if (!"BiocManager" %in% rownames(installed.packages()))
install.packages("BiocManager")
BiocManager::install("rmelting")
The development version can be installed from github as follows.
if (!require('devtools')) install.packages('devtools')
devtools::install_github("aravind-j/rmelting")
Then the package can be loaded as follows.
library(rmelting)
Basic usage
Melting temperatures are computed in rmelting through the core function melting which takes a number of arguments (see ?melting). The following are the essential arguments which are mandatory for computation.
sequence
- 5' to 3' sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL (Table 1). U and T are not considered identical.
Table 1: Recognized sequences
if (requireNamespace("readxl", quietly = TRUE)) {
ntides <- read_excel("Tables.xlsx", sheet = "MELTING", col_names = TRUE)
knitr::kable(ntides)
} else {
print("Package 'readxl' is required to generate this table.")
}
-
Comp.sequence
- Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of
sequence. Self-complementarity in sequence is detected even though there may be (are) dangling end(s) and comp.sequence is computed.
-
nucleic.acid.conc
- In molar concentration (M or mol L^-1^).
-
Na.conc, Mg.conc, Tris.conc, K.conc
- At least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional.
-
hybridisation.type
- The possible options for hybridisation type are as follows (Table 2).
Table 2: Hybridisation type options
if (requireNamespace("readxl", quietly = TRUE)) {
hybtype <- read_excel("Tables.xlsx", sheet = "HybType", col_names = TRUE)
hybtype$Option <- paste("`", hybtype$Option, "`", "")
knitr::kable(hybtype)
} else {
print("Package 'readxl' is required to generate this table.")
}
With these arguments, the melting temperature can be computed as follows.
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
Only the melting temperature is given as a console output. However, the output can be assigned to an object which contains the details of the environment, options and the thermodynamics results as a list.
# Get output as list
out <- melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Environment output
out$Environment
# Options used
out$Options
# Thermodynamics results
out$Results
The command for the MELTING 5 java version is saved as an attribute in the list out and can be retrieved as follows.
# Command for MELTING 5
attributes(out)$command
Melting temperature computation
Melting temperature is computed by either approximative or nearest neighbour methods according to the length of the oligonucleotide sequences. For longer sequences (longer than the threshold value, the threshold value set by size.threshold with the default value 60) approximative method is used, while for others, nearest neighbour method is used.
Approximative methods
The approximative method for computation can be specified by the argument method.approx. The available methods are given in Table 3.
Table 3: Details of approximative methods
rmeltingtables(file = "Tables.xlsx", sheet = "Approx.methods",
def = "default", code = "Formula", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA:AGATTACACGACAATCTACATAGGTCTCTATCGGCTCGTATTTGAAGTTGTGTGCTCTGCAACTAACCTAAATTGGTATC
RNA:UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AAUUAGAGGCAGUAGAAAUUCGGCACCUCUCUGACAUCUGAACUUGUCCCCAUUCGCCUCCGUGCAUCCUAAGUGUAGUA
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AGAUUACACGACAAUCUACAUAGGUCUCUAUCGGCUCGUAUUUGAAGUUGUGUGCUCUGCAACUAACCUAAAUUGGUAUC
# Long Nucleotide sequence
DNAseq <- c("TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG")
RNAseq <- c("UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU")
# Approximative method - default (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Approximative method - wetdna91 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "wetdna91")
# Approximative method - ahs01 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "ahs01")
# Approximative method - che93 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93")
# Approximative method - che93corr (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93corr")
# Approximative method - schdot (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "schdot")
# Approximative method - owe69 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "owe69")
# Approximative method - san98 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "san98")
# Approximative method - default (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)
# Approximative method - wetrna91 (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1,
method.approx = "wetrna91")
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1,
method.approx = "wetdnarna91")
Nearest neighbour methods
Perfectly matching sequences
The nearest neighbour model for computation in case of perfectly matching sequences can be specified by the argument method.nn. The available methods are given in Table 4.
Table 4: Details of nearest neighbour methods for perfectly matching sequences
rmeltingtables(file = "Tables.xlsx", sheet = "NN.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
DNA:GTCACTCTGTCGTTACCAGC
RNA:CAGUGAGACAGCAAUGGUCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
# Nearest neighbour method - default (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Nearest neighbour method - all97 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")
# Nearest neighbour method - bre86 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")
# Nearest neighbour method - san04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")
# Nearest neighbour method - san96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")
# Nearest neighbour method - sug96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")
# Nearest neighbour method - tan04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")
# Nearest neighbour method - default (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)
# Nearest neighbour method - xia98 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")
# Nearest neighbour method - fre86 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")
# Nearest neighbour method - default (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1)
# Nearest neighbour method - tur06 (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1, method.nn = "tur06")
# Nearest neighbour method - default (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)
# Nearest neighbour method - sug95 (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1, method.nn = "sug95")
Self complementarity for perfect matching sequences or sequences with dangling ends is detected automatically. However it can be enforced by the argument force.self = TRUE.
Examples
DNA:CATATGGCCATATG
||||||||||||||
DNA:GTATACCGGTATAC
RNA:AUGUACAU
||||||||
RNA:UACAUGUA
# Nearest neighbour method - default (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Nearest neighbour method - all97 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")
# Nearest neighbour method - bre86 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")
# Nearest neighbour method - san04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")
# Nearest neighbour method - san96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")
# Nearest neighbour method - sug96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")
# Nearest neighbour method - tan04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")
# Nearest neighbour method - default (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)
# Nearest neighbour method - xia98 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")
# Nearest neighbour method - fre86 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")
GU wobble base pairs effect
The nearest neighbour model for computation in case of sequences with GU wobble base pairs can be specified by the argument method.GU. The available methods are given in Table 5.
Table 5: Details of methods for sequences with GU wobble base pairs
rmeltingtables(file = "Tables.xlsx", sheet = "GU.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
RNA:CCAGCGUCCU
||||||||||
RNA:GGTCGCAGGA
# GU wobble base pairs effect - default (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1)
# GU wobble base pairs effect - ser12 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "ser12")
# GU wobble base pairs effect - tur99 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "tur99")
Single mismatch effect
The nearest neighbour model for computation in case of sequences with a single mismatch can be specified by the argument method.singleMM. The available methods are given in Table 6.
Table 6: Details of methods for sequences with single mismatch
rmeltingtables(file = "Tables.xlsx", sheet = "singleMM.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:CAACTTGATATTAATA
|||||||| |||||||
DNA:GTTGAACTCTAATTAT
RNA:GACAGGCUG
|||| ||||
RNA:CUGUGCGAC
DNA:CCATAACTACC
|||| ||||||
RNA:GGUAAUGAUGG
# Single mismatch effect - default (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)
# Single mismatch effect - allsanpey (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.singleMM = "allsanpey")
# Single mismatch effect - default (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)
# Single mismatch effect - zno07 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno07")
# Single mismatch effect - zno08 (RNA/RNA)
melting(sequence = "CAGUACGUC", comp.sequence = "GUCGGGCAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno08")
# Single mismatch effect - tur06 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "tur06")
# Single mismatch effect - default (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1)
# Single mismatch effect - wat11 (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna",
Na.conc = 1, method.singleMM = "wat11")
Tandem mismatches effect
The nearest neighbour model for computation in case of sequences with tandem mismatches can be specified by the argument method.tandemMM. The available methods are given in Table 7.
Table 7: Details of methods for sequences with tandem mismatches
rmeltingtables(file = "Tables.xlsx", sheet = "tandemMM.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:GACGTTGGAC
|||| ||||
DNA:CTGCGGCCTG
RNA:GAGCGGAG
||| |||
RNA:CUCCACUC
# Tandem mismatches effect - default (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)
# Tandem mismatches effect - allsanpey (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.tandemMM = "allsanpey")
# Tandem mismatches effect - default (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)
# Tandem mismatches effect - tur06 (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.tandemMM = "tur99")
Single dangling end effect
The nearest neighbour model for computation in case of sequences with a single dangling end can be specified by the argument method.single.dangle. The available methods are given in Table 8.
Table 8: Details of methods for sequences with single dangling end
rmeltingtables(file = "Tables.xlsx", sheet = "single.dangle.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:-GTAGCTACA
||||||||
DNA:ACATCGATG-
RNA:-GGCGCUG
|||||||
RNA: CCGCGAC
DNA:-GGCGCUG
|||||||
RNA: CCGCGAC
# Single dangling end effect - default (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)
# Single dangling end effect - bom00 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "bom00")
# Single dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "sugdna02")
# Single dangling end effect - default (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Single dangling end effect - ser08 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "ser08")
# Single dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "sugrna02")
Double dangling end effect
The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.double.dangle. The available methods are given in Table 9.
Table 9: Details of methods for sequences with double dangling ends
rmeltingtables(file = "Tables.xlsx", sheet = "double.dangle.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:--ATGCATAA
||||||
DNA:AATACGTA--
RNA:--AUGCAUAA
||||||
RNA:AAUACGUA--
# Double dangling end effect - default (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)
# Double dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.double.dangle = "sugdna02")
# Double dangling end effect - default (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Double dangling end effect - ser06 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser06")
# Double dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "sugrna02")
# Double dangling end effect - ser05 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser05")
Long dangling end effect
The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.long.dangle. The available methods are given in Table 10.
Table 10: Details of methods for sequences with long dangling ends
rmeltingtables(file = "Tables.xlsx", sheet = "long.dangle.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:----GCATATGCAAAA
||||||||
DNA:AAAACGTATACG----
RNA:AAAAGCAUAUGC----
||||||||
RNA:----CGUAUACGAAAA
# Long dangling end effect - default (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)
# Long dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.long.dangle = "sugdna02")
# Long dangling end effect - default (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Long dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.dangle = "sugrna02")
Internal loop effect
The nearest neighbour model for computation in case of sequences with an internal loop (more than two adjacent mismatches) can be specified by the argument method.internal.loop. The available methods are given in Table 11.
Table 11: Details of methods for sequences with internal loops
rmeltingtables(file = "Tables.xlsx", sheet = "internal.loop.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:GCGATTGGCACTTTGGTGAAC
||||| ||||||||||||
DNA:CGCTACATATGAAACCACTTG
RNA:GACAC-GCUG
|||| ||||
RNA:CUGUAUCGAC
# Internal loop effect - default (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Internal loop effect - san04 (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.internal.loop = "san04")
# Internal loop effect - default (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Internal loop effect - zno07 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "zno07")
# Internal loop effect - tur06 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "tur06")
Single bulge loop effect
The nearest neighbour model for computation in case of sequences with a single bulge loop can be specified by the argument method.single.bulge.loop. The available methods are given in Table 12.
Table 12: Details of methods for sequences with single bulge loop
rmeltingtables(file = "Tables.xlsx", sheet = "single.bulge.loop.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:TCGATTAGCGACACAGG
|||||||| ||||||||
DNA:AGCTAATC-CTGTGTCC
RNA:GACUCUGUC
|||| ||||
RNA:CUGA-ACAG
# Single bulge loop effect - default (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Single bulge loop effect - tan04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "tan04")
# Single bulge loop effect - san04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "san04")
# Single bulge loop effect - default (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Single bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "tur06")
# Single bulge loop effect - ser07 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "ser07")
Long bulge loop effect
The nearest neighbour model for computation in case of sequences with long bulge loop can be specified by the argument method.long.bulge.loop. The available methods are given in Table 13.
Table 13: Details of methods for sequences with long bulge loop
rmeltingtables(file = "Tables.xlsx", sheet = "long.bulge.loop.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:ATATGACGCCACAGCG
||||| ||||||||
DNA:TATAC---GGTGTCGC
RNA:AUAUGACGCCACAGCG
||||| ||||||||
RNA:UAUAC---GGUGUCGC
# Long bulge loop effect - default (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Long bulge loop effect - san04 (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.long.bulge.loop = "san04")
# Long bulge loop effect - default (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Long bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.bulge.loop = "tur06")
CNG repeats effect
The nearest neighbour model for computation in case of sequences with CNG repeats can be specified by the argument method.CNG. The available methods are given in Table 14.
Table 14: Details of methods for sequences with CNG repeats
rmeltingtables(file = "Tables.xlsx", sheet = "CNG.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
RNA:GCGGCGGCGGC
|||||||||||
RNA:CGCCGCCGCCG
# CNG repeats effect - default (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# CNG repeats effect - bro05 (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.CNG = "bro05")
Inosine bases effect
The nearest neighbour model for computation in case of sequences with inosine bases (I) can be specified by the argument method.inosine. The available methods are given in Table 15.
Table 15: Details of methods for sequences with inosine bases
rmeltingtables(file = "Tables.xlsx", sheet = "inosine.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
DNA:CCGICTGTIGCG
||| |||| |||
DNA:GGCCGACACCGC
RNA:GCAICGC
||| |||
RNA:CGUUGCG
# Inosine bases effect - default (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Inosine bases effect - san05 (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.inosine = "san05")
# Inosine bases effect - default (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)
# Inosine bases effect - zno07 (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.inosine = "zno07")
Hydroxyadenine bases effect
The nearest neighbour model for computation in case of sequences with hydroxyadenine bases can be specified by the argument method.hydroxyadenine. The available methods are given in Table 16.
Table 16: Details of methods for sequences with hydroxyadenine bases
rmeltingtables(file = "Tables.xlsx", sheet = "hydroxyadenine.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
*
DNA:AGAAATGACACGGTG
|||||||||||||||
DNA:TCTTTACCGTGCCAC
# Hydroxyadenine bases effect - default (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Hydroxyadenine bases effect - sug01 (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.hydroxyadenine = "sug01")
Azobenzenes effect
The nearest neighbour model for computation in case of sequences with azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) can be specified by the argument method.azobenzenes. The available methods are given in Table 17.
Table 17: Details of methods for sequences with azobenzenes
rmeltingtables(file = "Tables.xlsx", sheet = "azobenzenes.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
C C C C C
DNA:CTXTTAAXGAAGXGAGAXTATAXCC
|| |||| |||| |||| |||| ||
DNA:GA AATT CTTC CTCT ATAT GG
# Azobenzenes effect - default (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Azobenzenes effect - asa05 (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.azobenzenes = "asa05")
Locked nucleic acids effect
The nearest neighbour model for computation in case of sequences with locked nucleic acids can be specified by the argument method.locked. The available methods are given in Table 18.
Table 18: Details of methods for sequences with locked nucleic acids
rmeltingtables(file = "Tables.xlsx", sheet = "locked.methods",
def = "default", code = "Model", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
Examples
L
DNA:CCATTGCTACC
|||||||||||
DNA:GGTAACGATGG
# Locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)
# Locked nucleic acids effect - sug01 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.locked = "mct04")
Corrections
Once the melting temperature is computed, a correction is applied to it according to the concentration of nucleic acids, cations and/or denaturing agents.
Nucleic acid concentration
For self complementary sequences (auto detected or specified by force.self) it is 1. Otherwise it is 4 if the both strands are present in equivalent amount and 1 if one strand is in excess.
Ion corrections
Melting temperature is computed initially for $[\textrm{Na}^{+}]$ = 1 M, after which a correction for the presence of cations ($[\textrm{Na}^{+}]$, $[\textrm{K}^{+}]$, $[\textrm{Tris}^{+}]$ and $[\textrm{Mg}^{+}]$) is applied either directly on the computed melting temperature or on the computed entropy.
Th correction methods for cation concentration can be specified by the argument correction.ion.
Sodium corrections
The available correction methods for sodium concentration are given in Table 19.
Table 19: Details of the corrections for sodium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "na.correction",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# Na correction - default (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069)
# Na correction - owc2204 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2204")
# Na correction - ahs01 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "ahs01")
# Na correction - kam71 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "kam71")
# Na correction - marschdot (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "marschdot")
# Na correction - owc1904 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc1904")
# Na correction - owc2004 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2004")
# Na correction - owc2104 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2104")
# Na correction - san96 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san96")
# Na correction - san04 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san04")
# Na correction - schlif (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "schlif")
# Na correction - tanna06 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "tanna06")
# Na correction - wet91 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "wet91")
# Na correction - default (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069)
# Na correction - tanna07 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "tanna07")
# Na correction - wet91 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "wet91")
# Na correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069)
# Na correction - tanna07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, correction.ion = "tanna07")
# Na correction - default (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069)
# Na correction - wet91 (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069, correction.ion = "wet91")
Magnesium corrections
The available correction methods for magnesium concentration are given in Table 20.
Table 20: Details of the corrections for magnesium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "mg.correction",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015)
# Mg correction - owcmg08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "owcmg08")
# Mg correction - tanmg06 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "tanmg06")
# Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015)
# Mg correction - tanmg07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")
# Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015)
# Mg correction - tanmg07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")
Mixed Sodium and Magnesium corrections
The available correction methods for mixed sodium magnesium concentration are given in Table 21.
Table 21: Details of the corrections for mixed sodium and magnesium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "NaMg.correction",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# Mixed Na & Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)
# Mixed Na & Mg correction - owcmix08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "owcmix08")
# Mixed Na & Mg correction - tanmix07 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
# Mixed Na & Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015)
# Mixed Na & Mg correction - tanmix07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
# Mixed Na & Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015)
# Mixed Na & Mg correction - tanmix07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
The ion correction by @owczarzy_predicting_2008 is used by default according to the $\frac{[\textrm{Mg}^{2+}]^{0.5}}{[\textrm{Mon}^{+}]}$ ratio, where $[\textrm{Mon}^{+}] = \textrm{Na}^{+}]+[\textrm{Tris}^{+}]+[\textrm{K}^{+}]$.
If,
- $[\textrm{K}^{+}] = 0$, default sodium correction is used;
- Ratio $<$ 0.22, default sodium correction is used;
- 0.22 $\leq$ Ratio $<$ 6, default mixed Na and Mg correction is used and
- Ratio $\geq$ 6,default magnesium correction is used.
Note that $[\textrm{Tris}^{+}]$ is about half of the total tris buffer concentration.
Sodium equivalent concentration methods
The available correction methods for mixed sodium magnesium concentration are given in Table 22.
Table 22: Details of the methods for computation of sodium equivalent concentration in the presence of other ions
rmeltingtables(file = "Tables.xlsx", sheet = "Naeq.methods",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# Na equivalent concentration method - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)
# Na equivalent concentration method - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "ahs01")
# Na equivalent concentration method - mit96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "mit96")
# Na equivalent concentration method - pey00 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "pey00")
Denaturing agent corrections
These include melting temperature corrections for concentration of formamide and DMSO.
DMSO corrections
The available correction methods for DMSO concentration are given in Table 23.
Table 23: Details of the corrections for DMSO concentration
rmeltingtables(file = "Tables.xlsx", sheet = "DMSO.methods",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# DMSO correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10)
# DMSO correction - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "ahs01")
# DMSO correction - cul76 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "cul76")
# DMSO correction - esc80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "esc80")
# DMSO correction - mus80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "mus81")
Formamide corrections
The available correction methods for formamide concentration are given in Table 24.
Table 24: Details of the corrections for formamide concentration
rmeltingtables(file = "Tables.xlsx", sheet = "formamide.methods",
def = "default", code = "Correction", ref = "Reference")
* Default method for computation.
\begin{center}
\vspace{2pt}
\end{center}
# Formamide correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06)
# Formamide correction - bla96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06, correction.formamide = "bla96")
# Formamide correction - lincorr (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 10, correction.formamide = "lincorr")
Equivalent options in MELTING 5
The options in MELTING 5 command line equivalent to the arguments in rmelting are given in Table 25.
Table 24: Arguments in rmelting and their equivalent options in MELTING 5 command line.
options <- read_excel("Tables.xlsx", sheet = "commands", col_names = TRUE)[1:34, c(2,1)]
options$`MELTING 5` <- paste("-", options$`MELTING 5`, sep = "")
options$rmelting <- paste("`", options$rmelting, "`", sep = "")
colnames(options) <- c("`rmelting`", "MELTING 5 (command line)")
knitr::kable(options)
Batch computation
Melting temperature for multiple nucleic acid duplexes can be computed using the meltingBatch function.
sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC",
"CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA",
"CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC",
"CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG")
meltingBatch(sequence, nucleic.acid.conc = 0.0004,
hybridisation.type = "dnadna", Na.conc = 1)
Complementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.
seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG",
"CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC",
"CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC",
"GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG")
comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC",
"GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG",
"GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG",
"CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC")
meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004,
hybridisation.type = "rnarna", Na.conc = 1,
method.singleMM = "tur06")
Further reading
Further details about algorithm, formulae and methods are available in the MELTING 5 documentation.
Citing rmelting
detach("package:rmelting", unload = TRUE)
suppressPackageStartupMessages(library(rmelting))
cit <- citation("rmelting")
# yr <- format(Sys.Date(), "%Y")
# cit[1]$year <- yr
# oc <- class(cit)
#
# cit <- unclass(cit)
# attr(cit[[1]],"textVersion") <- gsub("\\(\\)",
# paste("\\(", yr, "\\)", sep = ""),
# attr(cit[[1]],"textVersion"))
# class(cit) <- oc
cit
Session Info
sessionInfo()
References
Try the rmelting package in your browser
Any scripts or data that you put into this service are public.
rmelting documentation built on Nov. 8, 2020, 5:19 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
out_type <- knitr::opts_knit$get("rmarkdown.pandoc.to") r = getOption("repos") r["CRAN"] = "https://cran.rstudio.com/" #r["CRAN"] = "https://cloud.r-project.org/" #r["CRAN"] = "https://ftp.iitm.ac.in/cran/" options(repos = r)
switch(out_type, html = {cat("<p>1. Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi.</p> <p>2. Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi.</p>")}, latex = cat("\\begin{center} 1. Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi. 2. Division of Crop Physiology, ICAR-Indian Agricultural Research Institute, New Delhi. \\end{center}" ) )
\begin{center} \vspace{6pt} \hrule \end{center}
knitr::opts_chunk$set(echo = TRUE) library(readxl) # x <- read_excel("vignettes/Tables.xlsx", sheet = "Approx.methods", col_names = TRUE) rmeltingtables <- function(file, sheet, def="default", code="Formula", ref = "Reference") { if (requireNamespace("readxl", quietly = TRUE)) { x <- read_excel(path = file, sheet = sheet, col_names = TRUE) x[,code] <- paste0("`", unlist(x[,code]), "`", sep = "") if (!is.null(def)) { ind <- which(is.na(x[,def]) %in% FALSE) x[ind,code] <- paste0(unlist(x[ind,code]), unlist(x[ind,def]), sep = "") rm(ind) } x[, def] <- NULL x[, ref] <- gsub("\\[|\\]", "", unlist(x[, ref])) x[, ref] <- gsub(";", ",", unlist(x[, ref])) x[, "Limits/Remarks"] <- gsub("(\\\\code\\{)(.+)(\\})", "`\\2`", unlist(x[, "Limits/Remarks"])) # x <- data.frame(x) pander::pander(x, style = 'multiline', split.cell = c(13, 10, 20, 20), justify = c('left'), split.table = Inf, keep.line.breaks = FALSE, use.hyphening = FALSE, missing = "") } else { print("Package 'readxl' is required to generate this table.") } }
\tableofcontents
\begin{wrapfigure}{r}{0.35\textwidth}
\vspace{-10pt}
\begin{center}
\includegraphics[width=0.33\textwidth]{r system.file("extdata", "rmelting.png", package = "rmelting")}
\end{center}
\vspace{-10pt}
\end{wrapfigure}
Introduction
The R package rmelting is an interface to the MELTING 5 program [@le_novere_melting_2001; @dumousseau_melting_2012] to compute melting temperatures of nucleic acid duplexes (DNA/DNA, DNA/RNA, RNA/RNA or 2'-O-MeRNA/RNA) along with other thermodynamic parameters such as hybridisation enthalpy and entropy.
Melting temperatures are computed by Nearest-neighbour methods for short sequences or approximative estimation formulae for long sequences. Apart from these, multiple corrections are available to take into account the presence of Cations (Na, Tris, K and Mg) or denaturing agents (DMSO and formamide).
Installation
The package can be installed from Bioconductor as follows.
if (!"BiocManager" %in% rownames(installed.packages())) install.packages("BiocManager") BiocManager::install("rmelting")
The development version can be installed from github as follows.
if (!require('devtools')) install.packages('devtools') devtools::install_github("aravind-j/rmelting")
Then the package can be loaded as follows.
library(rmelting)
Basic usage
Melting temperatures are computed in rmelting through the core function melting which takes a number of arguments (see ?melting). The following are the essential arguments which are mandatory for computation.
sequence- 5' to 3' sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL (Table 1). U and T are not considered identical.
Table 1: Recognized sequences
if (requireNamespace("readxl", quietly = TRUE)) { ntides <- read_excel("Tables.xlsx", sheet = "MELTING", col_names = TRUE) knitr::kable(ntides) } else { print("Package 'readxl' is required to generate this table.") }
-
Comp.sequence- Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of
sequence. Self-complementarity insequenceis detected even though there may be (are) dangling end(s) andcomp.sequenceis computed.
- Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of
-
nucleic.acid.conc- In molar concentration (M or mol L^-1^).
-
Na.conc, Mg.conc, Tris.conc, K.conc- At least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional.
-
hybridisation.type- The possible options for hybridisation type are as follows (Table 2).
Table 2: Hybridisation type options
if (requireNamespace("readxl", quietly = TRUE)) { hybtype <- read_excel("Tables.xlsx", sheet = "HybType", col_names = TRUE) hybtype$Option <- paste("`", hybtype$Option, "`", "") knitr::kable(hybtype) } else { print("Package 'readxl' is required to generate this table.") }
With these arguments, the melting temperature can be computed as follows.
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1)
Only the melting temperature is given as a console output. However, the output can be assigned to an object which contains the details of the environment, options and the thermodynamics results as a list.
# Get output as list out <- melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1) # Environment output out$Environment # Options used out$Options # Thermodynamics results out$Results
The command for the MELTING 5 java version is saved as an attribute in the list out and can be retrieved as follows.
# Command for MELTING 5 attributes(out)$command
Melting temperature computation
Melting temperature is computed by either approximative or nearest neighbour methods according to the length of the oligonucleotide sequences. For longer sequences (longer than the threshold value, the threshold value set by size.threshold with the default value 60) approximative method is used, while for others, nearest neighbour method is used.
Approximative methods
The approximative method for computation can be specified by the argument method.approx. The available methods are given in Table 3.
Table 3: Details of approximative methods
rmeltingtables(file = "Tables.xlsx", sheet = "Approx.methods", def = "default", code = "Formula", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA:AGATTACACGACAATCTACATAGGTCTCTATCGGCTCGTATTTGAAGTTGTGTGCTCTGCAACTAACCTAAATTGGTATC
RNA:UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AAUUAGAGGCAGUAGAAAUUCGGCACCUCUCUGACAUCUGAACUUGUCCCCAUUCGCCUCCGUGCAUCCUAAGUGUAGUA
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AGAUUACACGACAAUCUACAUAGGUCUCUAUCGGCUCGUAUUUGAAGUUGUGUGCUCUGCAACUAACCUAAAUUGGUAUC
# Long Nucleotide sequence DNAseq <- c("TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG") RNAseq <- c("UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU") # Approximative method - default (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1) # Approximative method - wetdna91 (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "wetdna91") # Approximative method - ahs01 (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "ahs01") # Approximative method - che93 (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "che93") # Approximative method - che93corr (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "che93corr") # Approximative method - schdot (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "schdot") # Approximative method - owe69 (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "owe69") # Approximative method - san98 (DNA/DNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.approx = "san98") # Approximative method - default (RNA/RNA) melting(sequence = RNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1) # Approximative method - wetrna91 (RNA/RNA) melting(sequence = RNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1, method.approx = "wetrna91") # Approximative method - wetdnarna91 (DNA/RNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnarna", Na.conc = 1) # Approximative method - wetdnarna91 (DNA/RNA) melting(sequence = DNAseq, nucleic.acid.conc = 2e-06, hybridisation.type = "dnarna", Na.conc = 1, method.approx = "wetdnarna91")
Nearest neighbour methods
Perfectly matching sequences
The nearest neighbour model for computation in case of perfectly matching sequences can be specified by the argument method.nn. The available methods are given in Table 4.
Table 4: Details of nearest neighbour methods for perfectly matching sequences
rmeltingtables(file = "Tables.xlsx", sheet = "NN.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
DNA:GTCACTCTGTCGTTACCAGC
RNA:CAGUGAGACAGCAAUGGUCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
# Nearest neighbour method - default (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1) # Nearest neighbour method - all97 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97") # Nearest neighbour method - bre86 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86") # Nearest neighbour method - san04 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04") # Nearest neighbour method - san96 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96") # Nearest neighbour method - sug96 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96") # Nearest neighbour method - tan04 (DNA/DNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04") # Nearest neighbour method - default (RNA/RNA: No Self-Complimentarity) melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1) # Nearest neighbour method - xia98 (RNA/RNA: No Self-Complimentarity) melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98") # Nearest neighbour method - fre86 (RNA/RNA: No Self-Complimentarity) melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86") # Nearest neighbour method - default (mRNA/RNA: No Self-Complimentarity) melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06, hybridisation.type = "mrnarna", Na.conc = 1) # Nearest neighbour method - tur06 (mRNA/RNA: No Self-Complimentarity) melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06, hybridisation.type = "mrnarna", Na.conc = 1, method.nn = "tur06") # Nearest neighbour method - default (DNA/RNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnarna", Na.conc = 1) # Nearest neighbour method - sug95 (DNA/RNA: No Self-Complimentarity) melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnarna", Na.conc = 1, method.nn = "sug95")
Self complementarity for perfect matching sequences or sequences with dangling ends is detected automatically. However it can be enforced by the argument force.self = TRUE.
Examples
DNA:CATATGGCCATATG
||||||||||||||
DNA:GTATACCGGTATAC
RNA:AUGUACAU
||||||||
RNA:UACAUGUA
# Nearest neighbour method - default (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1) # Nearest neighbour method - all97 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97") # Nearest neighbour method - bre86 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86") # Nearest neighbour method - san04 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04") # Nearest neighbour method - san96 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96") # Nearest neighbour method - sug96 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96") # Nearest neighbour method - tan04 (DNA/DNA: Self-Complimentarity) melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06, hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04") # Nearest neighbour method - default (RNA/RNA: Self-Complimentarity) melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1) # Nearest neighbour method - xia98 (RNA/RNA: Self-Complimentarity) melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98") # Nearest neighbour method - fre86 (RNA/RNA: Self-Complimentarity) melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06, hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")
GU wobble base pairs effect
The nearest neighbour model for computation in case of sequences with GU wobble base pairs can be specified by the argument method.GU. The available methods are given in Table 5.
Table 5: Details of methods for sequences with GU wobble base pairs
rmeltingtables(file = "Tables.xlsx", sheet = "GU.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
RNA:CCAGCGUCCU
||||||||||
RNA:GGTCGCAGGA
# GU wobble base pairs effect - default (RNA/RNA) melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # GU wobble base pairs effect - ser12 (RNA/RNA) melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.GU = "ser12") # GU wobble base pairs effect - tur99 (RNA/RNA) melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.GU = "tur99")
Single mismatch effect
The nearest neighbour model for computation in case of sequences with a single mismatch can be specified by the argument method.singleMM. The available methods are given in Table 6.
Table 6: Details of methods for sequences with single mismatch
rmeltingtables(file = "Tables.xlsx", sheet = "singleMM.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:CAACTTGATATTAATA
|||||||| |||||||
DNA:GTTGAACTCTAATTAT
RNA:GACAGGCUG
|||| ||||
RNA:CUGUGCGAC
DNA:CCATAACTACC
|||| ||||||
RNA:GGUAAUGAUGG
# Single mismatch effect - default (DNA/DNA) melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1) # Single mismatch effect - allsanpey (DNA/DNA) melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.singleMM = "allsanpey") # Single mismatch effect - default (RNA/RNA) melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Single mismatch effect - zno07 (RNA/RNA) melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.singleMM = "zno07") # Single mismatch effect - zno08 (RNA/RNA) melting(sequence = "CAGUACGUC", comp.sequence = "GUCGGGCAG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.singleMM = "zno08") # Single mismatch effect - tur06 (RNA/RNA) melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.singleMM = "tur06") # Single mismatch effect - default (DNA/RNA) melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG", nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1) # Single mismatch effect - wat11 (DNA/RNA) melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG", nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1, method.singleMM = "wat11")
Tandem mismatches effect
The nearest neighbour model for computation in case of sequences with tandem mismatches can be specified by the argument method.tandemMM. The available methods are given in Table 7.
Table 7: Details of methods for sequences with tandem mismatches
rmeltingtables(file = "Tables.xlsx", sheet = "tandemMM.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:GACGTTGGAC
|||| ||||
DNA:CTGCGGCCTG
RNA:GAGCGGAG
||| |||
RNA:CUCCACUC
# Tandem mismatches effect - default (DNA/DNA) melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1) # Tandem mismatches effect - allsanpey (DNA/DNA) melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.tandemMM = "allsanpey") # Tandem mismatches effect - default (RNA/RNA) melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Tandem mismatches effect - tur06 (RNA/RNA) melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.tandemMM = "tur99")
Single dangling end effect
The nearest neighbour model for computation in case of sequences with a single dangling end can be specified by the argument method.single.dangle. The available methods are given in Table 8.
Table 8: Details of methods for sequences with single dangling end
rmeltingtables(file = "Tables.xlsx", sheet = "single.dangle.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:-GTAGCTACA |||||||| DNA:ACATCGATG- RNA:-GGCGCUG ||||||| RNA: CCGCGAC DNA:-GGCGCUG ||||||| RNA: CCGCGAC
# Single dangling end effect - default (DNA/DNA) melting(sequence = "-GTAGCTACA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1) # Single dangling end effect - bom00 (DNA/DNA) melting(sequence = "-GTAGCTACA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.single.dangle = "bom00") # Single dangling end effect - sugdna02 (DNA/DNA) melting(sequence = "-GTAGCTACA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.single.dangle = "sugdna02") # Single dangling end effect - default (RNA/RNA) melting(sequence = "-GGCGCUG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Single dangling end effect - ser08 (RNA/RNA) melting(sequence = "-GGCGCUG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.single.dangle = "ser08") # Single dangling end effect - sugrna02 (RNA/RNA) melting(sequence = "-GGCGCUG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.single.dangle = "sugrna02")
Double dangling end effect
The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.double.dangle. The available methods are given in Table 9.
Table 9: Details of methods for sequences with double dangling ends
rmeltingtables(file = "Tables.xlsx", sheet = "double.dangle.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:--ATGCATAA |||||| DNA:AATACGTA-- RNA:--AUGCAUAA |||||| RNA:AAUACGUA--
# Double dangling end effect - default (DNA/DNA) melting(sequence = "--ATGCATAA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1) # Double dangling end effect - sugdna02 (DNA/DNA) melting(sequence = "--ATGCATAA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.double.dangle = "sugdna02") # Double dangling end effect - default (RNA/RNA) melting(sequence = "--AUGCAUAA", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Double dangling end effect - ser06 (RNA/RNA) melting(sequence = "--AUGCAUAA", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.double.dangle = "ser06") # Double dangling end effect - sugrna02 (RNA/RNA) melting(sequence = "--AUGCAUAA", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.double.dangle = "sugrna02") # Double dangling end effect - ser05 (RNA/RNA) melting(sequence = "--AUGCAUAA", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.double.dangle = "ser05")
Long dangling end effect
The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.long.dangle. The available methods are given in Table 10.
Table 10: Details of methods for sequences with long dangling ends
rmeltingtables(file = "Tables.xlsx", sheet = "long.dangle.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:----GCATATGCAAAA |||||||| DNA:AAAACGTATACG---- RNA:AAAAGCAUAUGC---- |||||||| RNA:----CGUAUACGAAAA
# Long dangling end effect - default (DNA/DNA) melting(sequence = "----GCATATGCAAAA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1) # Long dangling end effect - sugdna02 (DNA/DNA) melting(sequence = "----GCATATGCAAAA", nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1, method.long.dangle = "sugdna02") # Long dangling end effect - default (RNA/RNA) melting(sequence = "AAAAGCAUAUGC----", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Long dangling end effect - sugrna02 (RNA/RNA) melting(sequence = "AAAAGCAUAUGC----", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.long.dangle = "sugrna02")
Internal loop effect
The nearest neighbour model for computation in case of sequences with an internal loop (more than two adjacent mismatches) can be specified by the argument method.internal.loop. The available methods are given in Table 11.
Table 11: Details of methods for sequences with internal loops
rmeltingtables(file = "Tables.xlsx", sheet = "internal.loop.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:GCGATTGGCACTTTGGTGAAC
||||| ||||||||||||
DNA:CGCTACATATGAAACCACTTG
RNA:GACAC-GCUG
|||| ||||
RNA:CUGUAUCGAC
# Internal loop effect - default (DNA/DNA) melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Internal loop effect - san04 (DNA/DNA) melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.internal.loop = "san04") # Internal loop effect - default (RNA/RNA) melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Internal loop effect - zno07 (RNA/RNA) melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.internal.loop = "zno07") # Internal loop effect - tur06 (RNA/RNA) melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.internal.loop = "tur06")
Single bulge loop effect
The nearest neighbour model for computation in case of sequences with a single bulge loop can be specified by the argument method.single.bulge.loop. The available methods are given in Table 12.
Table 12: Details of methods for sequences with single bulge loop
rmeltingtables(file = "Tables.xlsx", sheet = "single.bulge.loop.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:TCGATTAGCGACACAGG
|||||||| ||||||||
DNA:AGCTAATC-CTGTGTCC
RNA:GACUCUGUC
|||| ||||
RNA:CUGA-ACAG
# Single bulge loop effect - default (DNA/DNA) melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Single bulge loop effect - tan04 (DNA/DNA) melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.single.bulge.loop = "tan04") # Single bulge loop effect - san04 (DNA/DNA) melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.single.bulge.loop = "san04") # Single bulge loop effect - default (RNA/RNA) melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Single bulge loop effect - tur06 (RNA/RNA) melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.single.bulge.loop = "tur06") # Single bulge loop effect - ser07 (RNA/RNA) melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.single.bulge.loop = "ser07")
Long bulge loop effect
The nearest neighbour model for computation in case of sequences with long bulge loop can be specified by the argument method.long.bulge.loop. The available methods are given in Table 13.
Table 13: Details of methods for sequences with long bulge loop
rmeltingtables(file = "Tables.xlsx", sheet = "long.bulge.loop.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:ATATGACGCCACAGCG
||||| ||||||||
DNA:TATAC---GGTGTCGC
RNA:AUAUGACGCCACAGCG
||||| ||||||||
RNA:UAUAC---GGUGUCGC
# Long bulge loop effect - default (DNA/DNA) melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Long bulge loop effect - san04 (DNA/DNA) melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.long.bulge.loop = "san04") # Long bulge loop effect - default (RNA/RNA) melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Long bulge loop effect - tur06 (RNA/RNA) melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.long.bulge.loop = "tur06")
CNG repeats effect
The nearest neighbour model for computation in case of sequences with CNG repeats can be specified by the argument method.CNG. The available methods are given in Table 14.
Table 14: Details of methods for sequences with CNG repeats
rmeltingtables(file = "Tables.xlsx", sheet = "CNG.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
RNA:GCGGCGGCGGC
|||||||||||
RNA:CGCCGCCGCCG
# CNG repeats effect - default (RNA/RNA) melting(sequence = "GCGGCGGCGGC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # CNG repeats effect - bro05 (RNA/RNA) melting(sequence = "GCGGCGGCGGC", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.CNG = "bro05")
Inosine bases effect
The nearest neighbour model for computation in case of sequences with inosine bases (I) can be specified by the argument method.inosine. The available methods are given in Table 15.
Table 15: Details of methods for sequences with inosine bases
rmeltingtables(file = "Tables.xlsx", sheet = "inosine.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
DNA:CCGICTGTIGCG
||| |||| |||
DNA:GGCCGACACCGC
RNA:GCAICGC
||| |||
RNA:CGUUGCG
# Inosine bases effect - default (DNA/DNA) melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Inosine bases effect - san05 (DNA/DNA) melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.inosine = "san05") # Inosine bases effect - default (RNA/RNA) melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1) # Inosine bases effect - zno07 (RNA/RNA) melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG", nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1, method.inosine = "zno07")
Hydroxyadenine bases effect
The nearest neighbour model for computation in case of sequences with hydroxyadenine bases can be specified by the argument method.hydroxyadenine. The available methods are given in Table 16.
Table 16: Details of methods for sequences with hydroxyadenine bases
rmeltingtables(file = "Tables.xlsx", sheet = "hydroxyadenine.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
*
DNA:AGAAATGACACGGTG
|||||||||||||||
DNA:TCTTTACCGTGCCAC
# Hydroxyadenine bases effect - default (DNA/DNA) melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Hydroxyadenine bases effect - sug01 (DNA/DNA) melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.hydroxyadenine = "sug01")
Azobenzenes effect
The nearest neighbour model for computation in case of sequences with azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) can be specified by the argument method.azobenzenes. The available methods are given in Table 17.
Table 17: Details of methods for sequences with azobenzenes
rmeltingtables(file = "Tables.xlsx", sheet = "azobenzenes.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
C C C C C
DNA:CTXTTAAXGAAGXGAGAXTATAXCC
|| |||| |||| |||| |||| ||
DNA:GA AATT CTTC CTCT ATAT GG
# Azobenzenes effect - default (DNA/DNA) melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Azobenzenes effect - asa05 (DNA/DNA) melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.azobenzenes = "asa05")
Locked nucleic acids effect
The nearest neighbour model for computation in case of sequences with locked nucleic acids can be specified by the argument method.locked. The available methods are given in Table 18.
Table 18: Details of methods for sequences with locked nucleic acids
rmeltingtables(file = "Tables.xlsx", sheet = "locked.methods", def = "default", code = "Model", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
Examples
L
DNA:CCATTGCTACC
|||||||||||
DNA:GGTAACGATGG
# Locked nucleic acids effect - default (DNA/DNA) melting(sequence = "CCATTLGCTACC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1) # Locked nucleic acids effect - sug01 (DNA/DNA) melting(sequence = "CCATTLGCTACC", nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna", Na.conc = 1, method.locked = "mct04")
Corrections
Once the melting temperature is computed, a correction is applied to it according to the concentration of nucleic acids, cations and/or denaturing agents.
Nucleic acid concentration
For self complementary sequences (auto detected or specified by force.self) it is 1. Otherwise it is 4 if the both strands are present in equivalent amount and 1 if one strand is in excess.
Ion corrections
Melting temperature is computed initially for $[\textrm{Na}^{+}]$ = 1 M, after which a correction for the presence of cations ($[\textrm{Na}^{+}]$, $[\textrm{K}^{+}]$, $[\textrm{Tris}^{+}]$ and $[\textrm{Mg}^{+}]$) is applied either directly on the computed melting temperature or on the computed entropy.
Th correction methods for cation concentration can be specified by the argument correction.ion.
Sodium corrections
The available correction methods for sodium concentration are given in Table 19.
Table 19: Details of the corrections for sodium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "na.correction", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# Na correction - default (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069) # Na correction - owc2204 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "owc2204") # Na correction - ahs01 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "ahs01") # Na correction - kam71 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "kam71") # Na correction - marschdot (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "marschdot") # Na correction - owc1904 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "owc1904") # Na correction - owc2004 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "owc2004") # Na correction - owc2104 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "owc2104") # Na correction - san96 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "san96") # Na correction - san04 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "san04") # Na correction - schlif (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "schlif") # Na correction - tanna06 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "tanna06") # Na correction - wet91 (DNA/DNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, correction.ion = "wet91") # Na correction - default (RNA/RNA) melting(sequence = "CCAGCCAGUCUCUCC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Na.conc = 0.069) # Na correction - tanna07 (RNA/RNA) melting(sequence = "CCAGCCAGUCUCUCC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Na.conc = 0.069, correction.ion = "tanna07") # Na correction - wet91 (RNA/RNA) melting(sequence = "CCAGCCAGUCUCUCC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Na.conc = 0.069, correction.ion = "wet91") # Na correction - default (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Na.conc = 0.069) # Na correction - tanna07 (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Na.conc = 0.069, correction.ion = "tanna07") # Na correction - default (DNA/RNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna", Na.conc = 0.069) # Na correction - wet91 (DNA/RNA) melting(sequence = "CCAGCCAGTCTCTCC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna", Na.conc = 0.069, correction.ion = "wet91")
Magnesium corrections
The available correction methods for magnesium concentration are given in Table 20.
Table 20: Details of the corrections for magnesium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "mg.correction", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# Mg correction - default (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Mg.conc = 0.0015) # Mg correction - owcmg08 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Mg.conc = 0.0015, correction.ion = "owcmg08") # Mg correction - tanmg06 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Mg.conc = 0.0015, correction.ion = "tanmg06") # Mg correction - default (RNA/RNA) melting(sequence = "CAGCCUCGUCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Mg.conc = 0.0015) # Mg correction - tanmg07 (RNA/RNA) melting(sequence = "CAGCCUCGUCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Mg.conc = 0.0015, correction.ion = "tanmg07") # Mg correction - default (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Mg.conc = 0.0015) # Mg correction - tanmg07 (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Mg.conc = 0.0015, correction.ion = "tanmg07")
Mixed Sodium and Magnesium corrections
The available correction methods for mixed sodium magnesium concentration are given in Table 21.
Table 21: Details of the corrections for mixed sodium and magnesium concentration
rmeltingtables(file = "Tables.xlsx", sheet = "NaMg.correction", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# Mixed Na & Mg correction - default (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015) # Mixed Na & Mg correction - owcmix08 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "owcmix08") # Mixed Na & Mg correction - tanmix07 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07") # Mixed Na & Mg correction - default (RNA/RNA) melting(sequence = "CAGCCUCGUCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Na.conc = 0.069, Mg.conc = 0.0015) # Mixed Na & Mg correction - tanmix07 (RNA/RNA) melting(sequence = "CAGCCUCGUCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna", Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07") # Mixed Na & Mg correction - default (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Na.conc = 0.069, Mg.conc = 0.0015) # Mixed Na & Mg correction - tanmix07 (mRNA/RNA) melting(sequence = "UACGCGUCAAUAACGCUA", nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna", Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
The ion correction by @owczarzy_predicting_2008 is used by default according to the $\frac{[\textrm{Mg}^{2+}]^{0.5}}{[\textrm{Mon}^{+}]}$ ratio, where $[\textrm{Mon}^{+}] = \textrm{Na}^{+}]+[\textrm{Tris}^{+}]+[\textrm{K}^{+}]$.
If,
- $[\textrm{K}^{+}] = 0$, default sodium correction is used;
- Ratio $<$ 0.22, default sodium correction is used;
- 0.22 $\leq$ Ratio $<$ 6, default mixed Na and Mg correction is used and
- Ratio $\geq$ 6,default magnesium correction is used.
Note that $[\textrm{Tris}^{+}]$ is about half of the total tris buffer concentration.
Sodium equivalent concentration methods
The available correction methods for mixed sodium magnesium concentration are given in Table 22.
Table 22: Details of the methods for computation of sodium equivalent concentration in the presence of other ions
rmeltingtables(file = "Tables.xlsx", sheet = "Naeq.methods", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# Na equivalent concentration method - default (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015) # Na equivalent concentration method - ahs01 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "ahs01") # Na equivalent concentration method - mit96 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "mit96") # Na equivalent concentration method - pey00 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "pey00")
Denaturing agent corrections
These include melting temperature corrections for concentration of formamide and DMSO.
DMSO corrections
The available correction methods for DMSO concentration are given in Table 23.
Table 23: Details of the corrections for DMSO concentration
rmeltingtables(file = "Tables.xlsx", sheet = "DMSO.methods", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# DMSO correction - default (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, DMSO.conc = 10) # DMSO correction - ahs01 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, DMSO.conc = 10, correction.DMSO = "ahs01") # DMSO correction - cul76 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, DMSO.conc = 10, correction.DMSO = "cul76") # DMSO correction - esc80 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, DMSO.conc = 10, correction.DMSO = "esc80") # DMSO correction - mus80 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, DMSO.conc = 10, correction.DMSO = "mus81")
Formamide corrections
The available correction methods for formamide concentration are given in Table 24.
Table 24: Details of the corrections for formamide concentration
rmeltingtables(file = "Tables.xlsx", sheet = "formamide.methods", def = "default", code = "Correction", ref = "Reference")
* Default method for computation. \begin{center} \vspace{2pt} \end{center}
# Formamide correction - default (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, formamide.conc = 0.06) # Formamide correction - bla96 (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, formamide.conc = 0.06, correction.formamide = "bla96") # Formamide correction - lincorr (DNA/DNA) melting(sequence = "CAGCCTCGTCGCAGC", nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna", Na.conc = 1, formamide.conc = 10, correction.formamide = "lincorr")
Equivalent options in MELTING 5
The options in MELTING 5 command line equivalent to the arguments in rmelting are given in Table 25.
Table 24: Arguments in rmelting and their equivalent options in MELTING 5 command line.
options <- read_excel("Tables.xlsx", sheet = "commands", col_names = TRUE)[1:34, c(2,1)] options$`MELTING 5` <- paste("-", options$`MELTING 5`, sep = "") options$rmelting <- paste("`", options$rmelting, "`", sep = "") colnames(options) <- c("`rmelting`", "MELTING 5 (command line)") knitr::kable(options)
Batch computation
Melting temperature for multiple nucleic acid duplexes can be computed using the meltingBatch function.
sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC", "CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA", "CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC", "CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG") meltingBatch(sequence, nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)
Complementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.
seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG", "CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC", "CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC", "GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG") comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC", "GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG", "GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG", "CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC") meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004, hybridisation.type = "rnarna", Na.conc = 1, method.singleMM = "tur06")
Further reading
Further details about algorithm, formulae and methods are available in the MELTING 5 documentation.
Citing rmelting
detach("package:rmelting", unload = TRUE) suppressPackageStartupMessages(library(rmelting)) cit <- citation("rmelting") # yr <- format(Sys.Date(), "%Y") # cit[1]$year <- yr # oc <- class(cit) # # cit <- unclass(cit) # attr(cit[[1]],"textVersion") <- gsub("\\(\\)", # paste("\\(", yr, "\\)", sep = ""), # attr(cit[[1]],"textVersion")) # class(cit) <- oc cit
Session Info
sessionInfo()
References
Try the rmelting package in your browser
Any scripts or data that you put into this service are public.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.