Nothing
#' Calculate Jaccard Similarity of two character vectors
#'
#' @param a the first character vector
#' @param b the first character vector
#'
#' @param ngram_width the length of the shingles / ngrams used in the
#' similarity calculation
#'
#' @param nthread Maximum number of threads to use. If `NULL` (default),
#' Rayon's global thread pool is used, which typically uses all logical
#' CPU cores available.
#'
#' @return a vector of jaccard similarities of the strings
#'
#' @examples
#' jaccard_similarity(
#' c("the quick brown fox", "jumped over the lazy dog"),
#' c("the quck bron fx", "jumped over hte lazy dog")
#' )
#'
#' @export
jaccard_similarity <- function(a, b, ngram_width = 2, nthread = NULL) {
stopifnot(length(a) == length(b))
rust_jaccard_similarity(a, b, ngram_width, nthread)
}
#' Calculate Hamming distance of two character vectors
#'
#' @param a the first character vector
#' @param b the first character vector
#'
#' @param nthread Maximum number of threads to use. If `NULL` (default),
#' Rayon's global thread pool is used, which typically uses all logical
#' CPU cores available.
#'
#' @return a vector of hamming similarities of the strings
#'
#' @examples
#' hamming_distance(
#' c("ACGTCGATGACGTGATGCGTAGCGTA", "ACGTCGATGTGCTCTCGTCGATCTAC"),
#' c("ACGTCGACGACGTGATGCGCAGCGTA", "ACGTCGATGGGGTCTCGTCGATCTAC")
#' )
#'
#' @export
hamming_distance <- function(a, b, nthread = NULL) {
stopifnot(length(a) == length(b))
rust_hamming_distance(a, b, nthread)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.