mafft through outsider in RMAFFT (Multiple Alignment through Fast Fourier Transformation): Multiple alignment program for amino acid or nucleotide sequences offering range of methods: L-INS-i (accurate; for alignment of \<∼200 sequences), FFT-NS-2 (fast; for alignment of \<∼30,000 sequences), etc.
library(outsider)
#> ----------------
#> outsider v 0.1.0
#> ----------------
#> - Security notice: be sure of which modules you install
module_install(repo = 'dombennett/om..mafft')
#> -----------------------------------------------------
#> Warning: You are about to install an outsider module!
#> -----------------------------------------------------
#> Outsider modules install and run external programs
#> via Docker <https://www.docker.com>. These external
#> programs may communicate with the internet and could
#> potentially be malicious.
#>
#> Be sure to know the module you are about to install:
#> Is it from a trusted developer? Are colleagues using
#> it? Is it supposed to download lots of data? Is it
#> well used (e.g. check number of stars on GitHub)?
#> -----------------------------------------------------
#> Module information
#> -----------------------------------------------------
#> program: mafft
#> details: Multiple alignment program for amino acid or nucleotide sequences
#> docker: dombennett
#> github: dombennett
#> url: https://github.com/DomBennett/om..mafft
#> image: dombennett/om_mafft
#> container: om_mafft
#> package: om..mafft
#> Travis CI: Failing/Erroring
#> -----------------------------------------------------
#> Enter any key to continue or press Esc to quit
# module_help(repo = 'dombennett/om..mafft')
Small alignment example using the
--autoargument.
library(outsider)
mafft <- module_import(fname = 'mafft', repo = "dombennett/om..mafft")
# get help
mafft('--help')
#> ------------------------------------------------------------------------------
#> MAFFT v7.407 (2018/Jul/23)
#> https://mafft.cbrc.jp/alignment/software/
#> MBE 30:772-780 (2013), NAR 30:3059-3066 (2002)
#> ------------------------------------------------------------------------------
#> High speed:
#> % mafft in > out
#> % mafft --retree 1 in > out (fast)
#>
#> High accuracy (for <~200 sequences x <~2,000 aa/nt):
#> % mafft --maxiterate 1000 --localpair in > out (% linsi in > out is also ok)
#> % mafft --maxiterate 1000 --genafpair in > out (% einsi in > out)
#> % mafft --maxiterate 1000 --globalpair in > out (% ginsi in > out)
#>
#> If unsure which option to use:
#> % mafft --auto in > out
#>
#> --op # : Gap opening penalty, default: 1.53
#> --ep # : Offset (works like gap extension penalty), default: 0.0
#> --maxiterate # : Maximum number of iterative refinement, default: 0
#> --clustalout : Output: clustal format, default: fasta
#> --reorder : Outorder: aligned, default: input order
#> --quiet : Do not report progress
#> --thread # : Number of threads (if unsure, --thread -1)
# download
wd <- file.path(tempdir(), 'mafft_example')
if (!dir.exists(wd)) {
dir.create(wd)
}
# example DNA
seq_file <- file.path(wd, 'example_seq.fasta')
url <- 'https://raw.githubusercontent.com/DomBennett/om..pasta/master/example_seq.fasta'
download.file(url = url, destfile = seq_file)
# align
al_file <- file.path(wd, 'alignment.fasta')
mafft(arglist = c('--auto', '--quiet', seq_file, '>', al_file))
# verify
cat(paste0(readLines(al_file, n = 10), collapse = '\n'))
#> >X02729 Methanococcus vannielli. #
#> ----tatctattaccctacc----ctggggaatggcttggcttgaaacgccgatgaagga
#> cgtggtaagctgcgataagcctaggcgaggcgcaa-cagcctttgaacctaggatttccg
#> aatgggacttcctacttttgtaa--------------------tccgtaaggattggtaa
#> cgcgggggattgaagcatcttagtacccgcaggaaaagaaatca-actgaga-ttccgtt
#> agtagaggcgattgaacacggatcagggcaaactgaatcccttcg-------------gg
#> gagatgtggtgttatagggccttct------tttcgcctgttgagaaaagctgaagtt-g
#> actggaacg-tcacactatagagggtgaaagtcccgtaagcgcaatcgattcaggtt---
#> tgaagtgt-ccctgagtaccgtgcgttggatatcgcgcgggaatt-tgggaggcatcaac
#> ttccaactctaaatacgtttcaagaccgatagcgtac-tagtaccgcgagggaaagctga
# add new sequences using the --add argument
al_file2 <- file.path(wd, 'alignment2.fasta')
url <- 'https://raw.githubusercontent.com/DomBennett/om..mafft/master/test_data/extra_seqs.fasta'
extra_file <- file.path(wd, 'extra_seqs.fasta')
download.file(url = url, destfile = extra_file)
# (no "--quiet" this time)
mafft(arglist = c('--add', extra_file, '--reorder', al_file, '>', al_file2))
#> nadd = 3
#> nthread = 0
#> nthreadpair = 0
#> nthreadtb = 0
#> ppenalty_ex = 0
#> stacksize: 8192 kb
#> generating a scoring matrix for nucleotide (dist=200) ... done
#> Gap Penalty = -1.53, +0.00, +0.00
#>
#>
#>
#> Making a distance matrix ..
#>
#> There are 10 ambiguous characters.
#> 1 / 13
#> done.
#>
#> Constructing a UPGMA tree (efffree=0) ...
#> 0 / 13 10 / 13
#> done.
#>
#> Progressive alignment 1/2...
#> STEP 1 / 12 fSTEP 2 / 12 fSTEP 12 / 12 f
#> done.
#>
#> Making a distance matrix from msa..
#> 0 / 13
#> done.
#>
#> Constructing a UPGMA tree (efffree=1) ...
#> 0 / 13 10 / 13
#> done.
#>
#> Progressive alignment 2/2...
#> STEP 1 / 12 fSTEP 2 / 12 fSTEP 12 / 12 f
#> done.
#>
#> disttbfast (nuc) Version 7.407
#> alg=A, model=DNA200 (2), 1.53 (4.59), -0.00 (-0.00), noshift, amax=0.0
#> 0 thread(s)
#>
#>
#> Strategy:
#> FFT-NS-2 (Fast but rough)
#> Progressive method (guide trees were built 2 times.)
#>
#> If unsure which option to use, try 'mafft --auto input > output'.
#> For more information, see 'mafft --help', 'mafft --man' and the mafft page.
#>
#> The default gap scoring scheme has been changed in version 7.110 (2013 Oct).
#> It tends to insert more gaps into gap-rich regions than previous versions.
#> To disable this change, add the --leavegappyregion option.
mafft has the following signature:
mafft "--option" "input_file" > "output_file"
These arguments can be passed through R via the arglist as a character
vector as demonstrated in the example above. Note, option arguments
(--op, --ep, --maxiterate, etc.) must always precede the “input >
output” statement. Also note, --man does not via R.
Find out more by visiting the MAFFT homepage.

An outsider module
Learn more at outsider
website. Want to build your
own module? Check out outsider.devtools
website.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.