Build:
When working with a set of miRNAs, useful information includes
The miRNAmeConverter R package has been developed for handling naming challenges of mature miRNAs.
In addition we have developed a web interface that enables one to use the
translateMiRNAName function via web interface and is based on shiny
miRNAmeConverter-web.
If you make use of this package, please cite the following 'OpenAccess' publication to allow us to keep the package up to date:
Haunsberger SJ, Connolly NMC and Prehn JHM* (2016). “miRNAmeConverter: an R/Bioconductor package for translating mature miRNA names to different miRBase versions.” Bioinformatics. doi: 10.1093/bioinformatics/btw660.
The miRNAmeConverter package delivers results in a fast and transparent way. The main functions
The core function, translating miRNA names to different versions, is especially useful when dealing with miRNA tools other than miRBase. To retrieve targets from miRTarBase, for example, the miRNA name from version 20 is required, whereas the website miRecords only accepts version 17. The miRNAmeConverter can manage large sets of miRNA names and hence can be easily implemented into workflows.
The data set included in the package (miRNAs) is a collection of human miRNA names. It consists of valid miRNA names (some duplicates), incorrect names and features used as controls in experiments, such as the RNU44 as a house keeping gene for HT-qPCR assay plates from Applied Biosystems.
To load the package and gain access to the functions and sample dataset of the miRNAmeConverter package just run the following command:
> library(miRNAmeConverter)
According to the nomenclature used in the miRBase repository hsa-mir-29a is a
stem-loop sequence name. If we substitute the 'r' by a capital 'R' it
codes for the mature 3' miRNA hsa-miR-29a (or hsa-miR-29a-5p in the current
version). The miRNAs input value for the functions has to
be in form of a character vector. Algorithms of the package are not case
sensitive. This has the effect, that for example in the case hsa-mir-29a and
hsa-miR-29a as input values both will be considered as valid mature miRNA
names.
The MiRNANameConverter class is coded in S4 style. All functions offered by the miRNAmeConverter package are methods of that class. All methods can be displayed by
> ls("package:miRNAmeConverter")
# [1] "assessVersion" "checkMiRNAName" "currentVersion"
# [4] "example.miRNAs" "getMirbaseVersionsXandY" "MiRNANameConverter"
# [7] "nOrganisms" "nTotalEntries" "saveResults"
# [10] "show" "translateMiRNAName" "validOrganisms"
# [13] "validVersions"
The slot names (attributes) of the class can be displayed by
> slotNames("MiRNANameConverter")
[1] ".dbconn" ".currentVersion" ".validVersions" ".nOrganisms"
[5] ".nTotalEntries" ".validOrganisms"
An instance of the MiRNANameConverter class can be created by calling the
MiRNANameConverter function:
> MiRNANameConverter()
An object of class: MiRNANameConverter
- Most recent miRBase version provided in the package:[1] 22
- Valid miRBase versions: [1] 22.0 21.0 20.0 19.0 18.0 17.0 16.0 15.0 14.0 13.0 12.0 11.0 10.1 10.0
[15] 9.2 9.1 9.0 8.2 8.1 8.0 7.1 6.0
- Number of species: [1] 277
- Number of database entries among all versions: [1] 291613
We have given a set of mature miRNA names miRNAs and would like to check if
the names are actual miRNA names that
are or were listed in any miRBase version. Our miRNAs have the following
values:
> miRNAs = c("hsa-miR-422b", "mmu-mir-872", "gra-miR157b", "cel-miR-56*")
Our first step is to create an instance of the MiRNANameConverter class by
calling the constructor and saving it to the
variable nc.
> nc = MiRNANameConverter()
Now we check if the names are valid names listed in any of the provided miRBase versions:
> checkMiRNAName(nc, miRNAs)
[1] "hsa-miR-422b" "mmu-mir-872" "gra-miR157b" "cel-miR-56*"
The following set of miRNA names contains valid as well as invalid names.
# "RNU-6" and "bpcv1-miR-B23" are not valid
> miRNAs = c("hsa-miR-422b", "RNU-6", "mmu-miR-872", "gra-miR157b", "bpcv1-miR-B23", "bpcv1-miR-B1")
> nc = MiRNANameConverter() # Create MiRNANameConverter object
> checkMiRNAName(nc, miRNAs) # check names
The following miRNAs are not listed in the miRBase repository:
RNU-6; bpcv1-miR-B23
[1] "hsa-miR-422b" "mmu-miR-872" "gra-miR157b" "bpcv1-miR-B1"
This time the function prints information for the features that did not pass the check and therefore are not included in the return value.
Translating miRNA names to different versions is the most required function.
Let us assume we found a paper that shows that the miRNA "hsa-miR-422b" is
significantly differentially expressed under certain conditions. Assume further,
that we did a similar experiment but this miRNA does not show up in our analysis.
Instead we got "hsa-miR-378a-3p" from miRBase version 21. We see, that the
previous paper was released a couple of years ago so there might be a chance
that their miRNA could now run under a different name. We apply the
translateMiRNAName function with hsa-miR-422b as miRNA parameter and no
version. With no given version the function returns the miRBase version 21
by default.
> miRNA.paper = "hsa-miR-422b";
> nc = MiRNANameConverter() # Create MiRNANameConverter object
> translateMiRNAName(nc, miRNA.paper) # Translate miRNA names
mimat input v22.0
MIMAT0000732 MIMAT0000732 hsa-miR-422b hsa-miR-378a-3p
The result shows that these two miRNAs are actually the same. This is because
"hsa-miR-422b" is last listed in miRBase version 9.2. In version 10.0 it was
named "hsa-miR-378" which in the current version 21.0 runs under the name
"hsa-miR-378a-3p".
Another example with more diverse input names is shown below, with the
respective console output and the entry in the attribute description.
> miRNAs= c("hsa-miR-128b", "hsa-miR-213", "mmu-miR-302b*",
"mmu-miR-872", "ebv-miR-BART5", "bpcv1-miR-B23")
> nc = MiRNANameConverter() # Create MiRNANameConverter object
> result = translateMiRNAName( # Translate names
nc
,miRNAs
,sequenceFormat = 1
,versions = c(8, 8.1, 18, 21)
)
Following miRNA will be neglected (not listed in miRBase):
bpcv1-miR-B23
Following miRNA is not listed in the current miRBase version 22.0.
hsa-miR-128b
The console output shows us that one of the input values is not a miRNA
("bpcv1-miR-B23") and another is not listed in miRBase version 21
("hsa-miR-128b").
result
mimat input v8.0 v8.1
MIMAT0000270 MIMAT0000270 hsa-miR-213 hsa-miR-213 hsa-miR-181a*
MIMAT0003373 MIMAT0003373 mmu-miR-302b* mmu-miR-302b* mmu-miR-302b*
MIMAT0003413 MIMAT0003413 ebv-miR-BART5 <NA> ebv-miR-BART5
MIMAT0004934 MIMAT0004934 mmu-miR-872 <NA> <NA>
v18.0 v21.0
MIMAT0000270 hsa-miR-181a-3p hsa-miR-181a-3p
MIMAT0003373 mmu-miR-302b-5p mmu-miR-302b-5p
MIMAT0003413 ebv-miR-BART5 ebv-miR-BART5-5p
MIMAT0004934 mmu-miR-872-5p mmu-miR-872-5p
descriptionThe information, whether a miRNA is OK or not, is stored in form of
an attribute of the return value of the function. This data.frame object
provides information about every single input value and can be accessed via
the attr command followed by 'description'.
attr(result, 'description')
input.miRNA
bpcv1-miR-B23 bpcv1-miR-B23
ebv-miR-BART5 ebv-miR-BART5
hsa-miR-128b hsa-miR-128b
hsa-miR-213 hsa-miR-213
mmu-miR-302b* mmu-miR-302b*
mmu-miR-872 mmu-miR-872
information
bpcv1-miR-B23 This name is not listed in any miRBase version.
ebv-miR-BART5 OK
hsa-miR-128b This miRNA is not listed in the current miRBase version 22.0.
hsa-miR-213 OK
mmu-miR-302b* OK
mmu-miR-872 OK
sequencesSometimes it can be useful to confirm the sequence of miRNAs for selected
miRBase versions. In such a case all we have to do is checking out the
sequence attribute of our translation result.
attr(result, 'sequence')
## mimat input v8.0
## MIMAT0000270 MIMAT0000270 hsa-miR-213 ACCAUCGACCGUUGAUUGUACC
## MIMAT0003373 MIMAT0003373 mmu-miR-302b* ACUUUAACAUGGGAAUGCUUUCU
## MIMAT0003413 MIMAT0003413 ebv-miR-BART5 <NA>
## MIMAT0004934 MIMAT0004934 mmu-miR-872 <NA>
## v8.1 v18.0
## MIMAT0000270 ACCAUCGACCGUUGAUUGUACC ACCAUCGACCGUUGAUUGUACC
## MIMAT0003373 ACUUUAACAUGGGAAUGCUUUCU ACUUUAACAUGGGAAUGCUUUCU
## MIMAT0003413 CAAGGUGAAUAUAGCUGCCCAUCG CAAGGUGAAUAUAGCUGCCCAUCG
## MIMAT0004934 <NA> AAGGUUACUUGUUAGUUCAGG
## v21.0
## MIMAT0000270 ACCAUCGACCGUUGAUUGUACC
## MIMAT0003373 ACUUUAACAUGGGAAUGCUUUCU
## MIMAT0003413 CAAGGUGAAUAUAGCUGCCCAUCG
## MIMAT0004934 AAGGUUACUUGUUAGUUCAGG
Due to the fact that we called the translateMiRNAName function with the
parameter sequenceFormat = 1 the attribute only contains the sequence for
each version respectively. If we would like to have miRNA name and sequence
combined in one table we can call the translateMiRNAName function with
sequenceFormat = 2.
result = translateMiRNAName( # Translate names
nc
,miRNAs
,sequenceFormat = 2
,versions = c(17, 19, 21)
)
## Following miRNA will be neglected (not listed in miRBase):
## bpcv1-miR-B23
## Following miRNA is not listed in the current miRBase version 22.0.
## hsa-miR-128b
attr(result, 'sequence')
mimat input v17.0-miRNA
MIMAT0000270 MIMAT0000270 hsa-miR-213 hsa-miR-181a*
MIMAT0003373 MIMAT0003373 mmu-miR-302b* mmu-miR-302b*
MIMAT0003413 MIMAT0003413 ebv-miR-BART5 ebv-miR-BART5
MIMAT0004934 MIMAT0004934 mmu-miR-872 mmu-miR-872
v17.0-Sequence v19.0-miRNA
MIMAT0000270 ACCAUCGACCGUUGAUUGUACC hsa-miR-181a-3p
MIMAT0003373 ACUUUAACAUGGGAAUGCUUUCU mmu-miR-302b-5p
MIMAT0003413 CAAGGUGAAUAUAGCUGCCCAUCG ebv-miR-BART5-5p
MIMAT0004934 AAGGUUACUUGUUAGUUCAGG mmu-miR-872-5p
v19.0-Sequence v21.0-miRNA
MIMAT0000270 ACCAUCGACCGUUGAUUGUACC hsa-miR-181a-3p
MIMAT0003373 ACUUUAACAUGGGAAUGCUUUCU mmu-miR-302b-5p
MIMAT0003413 CAAGGUGAAUAUAGCUGCCCAUCG ebv-miR-BART5-5p
MIMAT0004934 AAGGUUACUUGUUAGUUCAGG mmu-miR-872-5p
v21.0-Sequence
MIMAT0000270 ACCAUCGACCGUUGAUUGUACC
MIMAT0003373 ACUUUAACAUGGGAAUGCUUUCU
MIMAT0003413 CAAGGUGAAUAUAGCUGCCCAUCG
MIMAT0004934 AAGGUUACUUGUUAGUUCAGG
In cases where one has a dataframe with expression values and miRNA names from a particular miRBase version it can be easier to just 'join' a second dataframe with valid miRNA names, such as from v17 to v22.
mirs = data.frame(
valuex = c(22.3, 21.5, 89.6),
mirna = c("hsa-miR-29a", "hsa-let-7f", "hsa-miR-181a*"))
nc = MiRNANameConverter(); # Create MiRNANameConverter object
x = getMirnasForMirbaseVersion(nc, version = 17)
merge(mirs, x, by.x = "mirna", by.y = "v17")
In the case where miRNAs are assigned to multiple accessions, records will be neglected.
Sometimes it is useful to know the miRBase version that a given set of miRNA
names is from. In this case one can use the assessVersion function to receive
the most likely miRBase version. The following example makes use of the
provided example-miRNAs-dataset.
nc = MiRNANameConverter() # Create MiRNANameConverter object
assessVersion(nc, example.miRNAs) # Assess most likely miRBase version
## Input: 355 unique miRNA names
## The following miRNAs are not listed in the miRBase repository:
## RNU48; RNU44; RNU6B; hsa-miR-517; 4343438
## miRNAs that could not be found in identified max version 9.0:
## hsa-miR-213; hsa-miR-425; hsa-miR-493
## -> 347 out of 350 valid miRNAs assigned to max version 9.0.
## version frequency
## 1 9.0 347
## 2 8.2 347
## 3 8.1 347
## 4 9.2 346
## 5 9.1 346
## 6 10.0 276
## 7 10.1 272
## 8 14.0 271
## 9 13.0 271
## 10 12.0 271
## 11 11.0 271
## 12 15.0 270
## 13 16.0 267
## 14 8.0 267
## 15 17.0 266
## 16 7.1 264
## 17 6.0 180
## 18 18.0 133
## 19 19.0 127
## 20 20.0 93
## 21 21.0 92
## 22 22.0 86
The console output shows that from the 384 input names
there were 355 unique values. Five of these
values are not listed in any miRBase version and were neglected. The return
value is a data.frame object with the two columns version and frequency.
It is ordered by frequency and version. It shows that 347 out of 350 valid
input miRNAs could be assigned to miRBase version 9.0. This is the highest
score and therefore the most likely miRBase version of the input mature
miRNA names.
Sometimes it is useful to save a variable to a file. Taking the translation
result from above we can do so by running the following command with default
settings:
saveResults(nc, result)
Three files will be saved, the miRNA name translation result, the description
and sequence. By default the files are tab-separated files without the parameter
quote set to FALSE. Other options can be applied and will be passed on to
the utils::write.table function.
The data used in the miRNAmeConverter package is obtained from the
miRBaseVersions.db
annotation package.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.