Description Usage Arguments Details Value Author(s) References See Also Examples
Calculates the percent sequence identity for a pairwise sequence alignment.
1 |
x |
a |
type |
one of percent sequence identity. One of |
Since there is no universal definition of percent sequence identity, the pid
function
calculates this statistic in the following types:
"PID1"
:100 * (identical positions) / (aligned positions + internal gap positions)
"PID2"
:100 * (identical positions) / (aligned positions)
"PID3"
:100 * (identical positions) / (length shorter sequence)
"PID4"
:100 * (identical positions) / (average length of the two sequences)
A numeric vector containing the specified sequence identity measures.
P. Aboyoun
A. May, Percent Sequence Identity: The Need to Be Explicit, Structure 2004, 12(5):737.
G. Raghava and G. Barton, Quantification of the variation in percentage identity for protein sequence alignments, BMC Bioinformatics 2006, 7:415.
pairwiseAlignment, PairwiseAlignments-class, match-utils
1 2 3 4 5 6 7 8 9 10 11 12 13 | s1 <- DNAString("AGTATAGATGATAGAT")
s2 <- DNAString("AGTAGATAGATGGATGATAGATA")
palign1 <- pairwiseAlignment(s1, s2)
palign1
pid(palign1)
palign2 <-
pairwiseAlignment(s1, s2,
substitutionMatrix =
nucleotideSubstitutionMatrix(match = 2, mismatch = 10, baseOnly = TRUE))
palign2
pid(palign2, type = "PID4")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.