melting: Compute melting temperature of a nucleic acid duplex
In aravind-j/rmelting: R Interface to MELTING 5
melting R Documentation
Compute melting temperature of a nucleic acid duplex
Description
Compute the enthalpy and entropy of helix-coil transition, and then the
melting temperature of a nucleic acid duplex with the
MELTING 5
software (Le Novère, 2001; Dumousseau et al., 2012).
Usage
melting(sequence, comp.sequence = NULL,
nucleic.acid.conc,
hybridisation.type = c("dnadna", "rnarna", "dnarna",
"rnadna", "mrnarna", "rnamrna"),
Na.conc, Mg.conc, Tris.conc, K.conc,
dNTP.conc, DMSO.conc, formamide.conc,
size.threshold = 60, force.self = FALSE, correction.factor,
method.approx = c("ahs01", "che93", "che93corr",
"schdot", "owe69", "san98",
"wetdna91", "wetrna91", "wetdnarna91"),
method.nn = c("all97", "bre86", "san04", "san96", "sug96",
"tan04", "fre86", "xia98", "sug95", "tur06"),
method.GU = c("tur99", "ser12"),
method.singleMM = c("allsanpey", "tur06", "zno07", "zno08", "wat11"),
method.tandemMM = c("allsanpey", "tur99"),
method.single.dangle = c("bom00", "sugdna02", "sugrna02", "ser08"),
method.double.dangle = c("sugdna02", "sugrna02", "ser05", "ser06"),
method.long.dangle = c("sugdna02", "sugrna02"),
method.internal.loop = c("san04", "tur06", "zno07"),
method.single.bulge.loop = c("tan04", "san04", "ser07" ,"tur06"),
method.long.bulge.loop = c("san04", "tur06"),
method.CNG = c("bro05"),
method.inosine = c("san05", "zno07"),
method.hydroxyadenine = c("sug01"),
method.azobenzenes = c("asa05"),
method.locked = c("owc11", "mct04"),
method.consecutive.locked = c("owc11"),
method.consecutive.locked.singleMM = c("owc11"),
correction.ion = c("ahs01", "kam71", "marschdot",
"owc1904", "owc2004", "owc2104",
"owc2204", "san96", "san04", "schlif",
"tanna06", "tanna07", "wet91",
"owcmg08", "tanmg06", "tanmg07",
"owcmix08", "tanmix07"),
method.Naeq = c("ahs01", "mit96", "pey00"),
correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
correction.formamide = c("bla96", "lincorr"))
Arguments
sequence
Sequence (5' to 3') of one strand of the nucleic acid duplex
as a character string (Note: Uridine and thymidine are not
considered as identical).
comp.sequence
Complementary sequence (3' to 5') of the nucleic acid
duplex as a character string.
nucleic.acid.conc
Concentration of the nucleic acid strand (M or
mol L-1) in
excess as a numeric value.
hybridisation.type
The hybridisation type. Either "dnadna",
"rnarna", "dnarna", "rnadna", "mrnarna" or
"rnamrna" (see Hybridisation type options).
Na.conc
Concentration of Na ions (M) as a positive numeric value (see
Ion and agent concentrations).
Mg.conc
Concentration of Mg ions (M) as a positive numeric value (see
Ion and agent concentrations).
Tris.conc
Concentration of Tris ions (M) as a positive numeric value
(see Ion and agent concentrations).
K.conc
Concentration of K ions (M) as a positive numeric value (see
Ion and agent concentrations).
dNTP.conc
Concentration of dNTP (M) as a positive numeric value (see
Ion and agent concentrations).
DMSO.conc
Concentration of DMSO (%) as a positive numeric value (see
Ion and agent concentrations).
formamide.conc
Concentration of formamide (M or % depending on
correction method) as a positive numeric value (see Ion and agent
concentrations).
size.threshold
Sequence length threshold to decide approximative or
nearest-neighbour approach for computation. Default is 60.
force.self
logical. Enforces that sequence is self
complementary and complementary sequence is not required (seed
Self complementary sequences). Default is FALSE.
correction.factor
Correction factor to be used to modulate the effect
of the nucleic acid concentration (nucleic.acid.conc) in the
computation of melting temperature (see Correction factor for
nucleic acid concentration).
method.approx
Specify the approximative formula to be used for melting
temperature calculation for sequences of length greater than
size.threshold. Either "ahs01", "che93",
"che93corr", "schdot", "owe69", "san98",
"wetdna91", "wetrna91" or "wetdnarna91" (see
Approximative formulas).
method.nn
Specify the nearest neighbor model to be used for melting
temperature calculation for perfectly matching sequences of length lesser
than size.threshold. Either "all97", "bre86",
"san04", "san96", "sug96", "tan04",
"fre86", "xia98", "sug95" or "tur06" (see
Perfectly matching sequences).
method.GU
Specify the nearest neighbor model to compute the
contribution of GU base pairs to the thermodynamic of helix-coil
transition. Either "tur99" or "ser12" (see GU wobble
base pairs effect).
method.singleMM
Specify the nearest neighbor model to compute the
contribution of single mismatch to the thermodynamic of helix-coil
transition. Either "allsanpey", "tur06", "zno07"
"zno08" or "wat11" (see Single mismatch effect).
method.tandemMM
Specify the nearest neighbor model to compute the
contribution of tandem mismatches to the thermodynamic of helix-coil
transition. Either "allsanpey" or "tur99" (see Tandem
mismatches effect).
method.single.dangle
Specify the nearest neighbor model to compute the
contribution of single dangling end to the thermodynamic of helix-coil
transition. Either "bom00", "sugdna02", "sugrna02" or
"ser08" (see Single dangling end effect).
method.double.dangle
Specify the nearest neighbor model to compute the
contribution of double dangling end to the thermodynamic of helix-coil
transition. Either "sugdna02", "sugrna02", "ser05" or
"ser06" (see Double dangling end effect).
method.long.dangle
Specify the nearest neighbor model to compute the
contribution of long dangling end to the thermodynamic of helix-coil
transition. Either "sugdna02" or "sugrna02" (see Long
dangling end effect).
method.internal.loop
Specify the nearest neighbor model to compute the
contribution of internal loop to the thermodynamic of helix-coil
transition. Either "san04", "tur06" or "zno07" (see
Internal loop effect).
method.single.bulge.loop
Specify the nearest neighbor model to compute
the contribution of single bulge loop to the thermodynamic of helix-coil
transition. Either "san04", "tan04", "ser07" or
"tur06" (see Single bulge loop effect).
method.long.bulge.loop
Specify the nearest neighbor model to compute
the contribution of long bulge loop to the thermodynamic of helix-coil
transition. Either "san04" or "tur06" (see Long bulge
loop effect).
method.CNG
Specify the nearest neighbor model to compute the
contribution of CNG repeats to the thermodynamic of helix-coil transition.
Available method is "bro05" (see CNG repeats effect).
method.inosine
Specify the specific nearest neighbor model to compute
the contribution of inosine bases (I) to the thermodynamic of helix-coil
transition. Either "san05" or "zno07" (see Inosine
bases effect).
method.hydroxyadenine
Specify the nearest neighbor model to compute
the contribution of hydroxyadenine bases (A*) to the thermodynamic of
helix-coil transition. Available method is "sug01" (see
Hydroxyadenine bases effect).
method.azobenzenes
Specify the nearest neighbor model to compute the
contribution of azobenzenes (X_T for trans azobenzenes and X_C for cis
azobenzenes) to the thermodynamic of helix-coil transition. Available
method is "asa05" (see Azobenzenes effect).
method.locked
Specify the nearest neighbor model to compute the
contribution of single locked nucleic acids (AL, GL, TL and CL) to the
thermodynamic of helix-coil transition. Either "owc11" or
"mct04" (see Single locked nucleic acids effect).
method.consecutive.locked
Specify the nearest neighbor model to
compute the contribution of consecutive locked nucleic acids (AL, GL, TL
and CL) to the thermodynamic of helix-coil transition. Available
method is "owc11" (see Consecutive locked nucleic acids
effect).
method.consecutive.locked.singleMM
Specify the nearest neighbor model
to compute the contribution of consecutive locked nucleic acids (AL, GL, TL
and CL) with a single mismatch to the thermodynamic of helix-coil
transition. Available method is "owc11" (see Consecutive
locked nucleic acids with single mismatch effect).
correction.ion
Specify the correction method for ions. Either one of
the following:
Na corrections"ahs01",
"kam71", "owc1904", "owc2004", "owc2104",
"owc2204", "san96", "san04", "schlif",
"tanna06", "wetdna91", "tanna07", "wetrna91" or
"wetdnarna91" (see Sodium corrections)
Mg
corrections"owcmg08", "tanmg06" or "tanmg07" (see
Magnesium corrections)
Mixed Na Mg
corrections"owcmix08", "tanmix07" or "tanmix07" (see
Mixed Sodium and Magnesium corrections)
.
method.Naeq
Specify the ion correction which gives a sodium equivalent
concentration if other cations are present. Either "ahs01",
"mit96" or "pey00" (see Sodium equivalent
concentration methods).
correction.DMSO
Specify the correction method for DMSO. Specify the
correction method for DMSO. Either "ahs01", "mus81",
"cul76" or "esc80" (see DMSO corrections).
correction.formamide
Specify the correction method for formamide.
Specify the correction method for formamide Either "bla96" or
"lincorr" (see Formamide corrections).
Value
A list with the following components:
Environment
A
list with details about the melting temperature computation environment.
Options
A list with details about the options (default or
user specified) used for melting temperature computation.
Results
A list with the results of the melting temperature
computation including the enthalpy and entropy in case of nearest neighbour
methods.
Message
Error and/or Warning messages, if any.
Mandatory arguments
The following are the arguments which are
mandatory for computation.
sequence5' to 3'
sequence of one strand of the nucleic acid duplex as a character string.
Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL. U and T are
not considered identical (see Recognized nucleotides).
comp.sequenceMandatory if there are mismatches, inosine(s)
or hydroxyadenine(s) between the two strands. If not specified, it is
computed as the complement of sequence. Self-complementarity in
sequence is detected even though there may be (are) dangling end(s)
and comp.sequence is computed (see Self complementary
sequences).
nucleic.acid.concSee Correction factor
for nucleic acid concentration.
Na.conc, Mg.conc, Tris.conc,
K.concAt least one cation (Na, Mg, Tris, K) concentration is mandatory,
the other agents(dNTP, DMSO, formamide) are optional (see Ion and
agent concentrations).
hybridisation.typeSee
Hybridisation type options.
Recognized nucleotides
Code
Type
A Adenine
C Cytosine
G Guanine
T Thymine
U Uracil
I Inosine
X_C Trans
azobenzenes
X_T Cis azobenzenes
A* Hydroxyadenine
AL
Locked nucleic acid
TL "
GL "
CL "
U and T are not considered identical.
Hybridisation type options
The details of the possible options for
hybridisation type specified in the argument hybridisation.type are
as follows:
Option Sequence
Complementary sequence
dnadna DNA DNA
rnarna RNA RNA
dnarna DNA RNA
rnadna RNA DNA
mrnarna 2-o-methyl RNA
RNA
rnamrna RNA 2-o-methyl RNA
This parameter determines the nature of the sequences in the arguments
sequence and comp.sequence.
Ion and agent concentrations
Ion concentrations are specified by
the arguments Na.conc, Mg.conc, Tris.conc and
K.conc, while agent concentrations are specified by the arguments
dNTP.conc, DMSO.conc and formamide.conc.
These values are used for different correction functions which
approximately adjusts for effects of these ions (Na, Mg, Tris, K) and/or
agents (dNTP, DMSO, formamide) on on thermodynamic stability of nucleic
acid duplexes. Their concentration limits depends on the correction method
used. All the concentrations must be in M, except for the DMSO (%) and
formamide (% or M depending on the correction method). Note that
[Tris+] is
about half of the total tris buffer concentration.
Self complementary sequences
Self complementarity for perfect
matching sequences or sequences with dangling ends is detected
automatically. However it can be enforced by the argument force.self
= TRUE.
Correction factor for nucleic acid concentration
For self
complementary sequences (Auto detected or specified by force.self)
it is 1. Otherwise it is 4 if the both strands are present in equivalent
amount and 1 if one strand is in excess.
Approximative estimation formulas
Formula Type Limits/Remarks
Reference
ahs01 DNA No mismatch von Ahsen
et al., 2001
che93 DNA No mismatch; Na=0, Mg=0.0015,
Marmur and Doty, 1962
Tris=0.01, K=0.05
che93corr DNA No mismatch; Na=0, Mg=0.0015, Marmur and
Doty, 1962
Tris=0.01, K=0.05
schdot
DNA No mismatch Wetmur, 1991; Marmur and
Doty,
1962; Chester and
Marshak, 1993; Schildkraut
and Lifson, 1965; Wahl et
al., 1987; Britten et
al.,
1974; Hall et al., 1980
owe69 DNA
No mismatch Owen et al., 1969;
Frank-Kamenetskii,
1971;
Blake, 1996; Blake and
Delcourt, 1998
san98 DNA No mismatch SantaLucia,
1998; von Ahsen
et al., 2001
wetdna91*
DNA Wetmur, 1991
wetrna91* RNA Wetmur,
1991
wetdnarna91* DNA/RNA Wetmur, 1991
* Default
formula for computation.
Note that calculation is increasingly incorrect when the length of the
duplex decreases. Further, it does not take into account nucleic acid
concentration.
Nearest neighbor models
Perfectly matching sequences
Model
Type Limits/Remarks Reference
all97* DNA Allawi and SantaLucia, 1997
tur06* 2'-O-MeRNA/ A sodium correction Kierzek et al.,
2006
RNA (san04) is
automatically
applied to
convert the entropy (Na =
0.1M) into the entropy (Na =
1M).
bre86
DNA Breslauer et al., 1986
san04 DNA
SantaLucia and Hicks, 2004
san96 DNA SantaLucia et
al., 1996
sug96 DNA Sugimoto et al., 1996
tan04 DNA Tanaka et al., 2004
fre86
RNA Freier et al., 1986
xia98* RNA Xia et
al., 1998
sug95* DNA/ SantaLucia et al., 1996
RNA
* Default model for computation.
GU wobble base pairs effect
Model
Type Limits/Remarks Reference
tur99 RNA Mathews et al., 1999
ser12*
RNA Chen et al., 2012
* Default model for computation.
GU base pairs are not taken into account by the approximative mode.
Single mismatch effect
Model
Type Limits.Remarks Reference
allsanpey* DNA Allawi and SantaLucia, 1997;
Allawi and SantaLucia, 1998;
Allawi and
SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Peyret et al., 1999
wat11* DNA/RNA
Watkins et al., 2011
tur06 RNA Lu et al., 2006
zno07* RNA Davis and Znosko, 2007
zno08 RNA At least one adjacent GU base Davis and
Znosko, 2008
pair.
* Default model for computation.
Single mismatches are not taken into account by the approximative mode.
Tandem mismatches effect
Model
Type Limits.Remarks Reference
allsanpey* DNA Only GT mismatches and TA/TG Allawi
and SantaLucia, 1997;
mismatches. Allawi and SantaLucia,
1998;
Allawi and SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Peyret et al., 1999
tur99* RNA No adjacent GU or UG base Mathews et al.,
1999; Lu et
pairs. al., 2006
* Default model for
computation.
Tandem mismatches are not taken into account by the approximative mode.
Note that not all the mismatched Crick's pairs have been investigated.
Single dangling end effect
Model
Type Limits.Remarks Reference
bom00* DNA Bommarito et al., 2000
sugdna02
DNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
sugrna02 RNA Only
terminal poly A self Ohmichi et al., 2002
complementary
sequences.
ser08* RNA Only 3' UA, GU and UG
O'Toole et al., 2006; Miller
terminal base pairs only 5'
et al., 2008
UG and GU terminal base
pairs.
* Default model for computation.
Single dangling ends are not taken into account by the approximative mode.
Double dangling end effect
Model
Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self Ohmichi et al.,
2002
complementary sequences.
sugrna02
RNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
ser05 RNA Depends on the
available O'Toole et al., 2005
thermodynamic parameters
for
single dangling end.
ser06*
RNA O'Toole et al., 2006
* Default model for computation.
Double dangling ends are not taken into account by the approximative mode.
Long dangling end effect
Model
Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self Ohmichi et
al., 2002
complementary sequences.
sugrna02*
RNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
* Default model for computation.
Long dangling ends are not taken into account by the approximative mode.
Internal loop effect
Model
Type Limits.Remarks Reference
san04* DNA Missing asymmetry penalty. SantaLucia and
Hicks, 2004
Not tested with experimental
results.
tur06 RNA Not tested with experimental
Lu et al., 2006
results.
zno07* RNA
Only for 1x2 loop. Badhwar et al., 2007
* Default model for
computation.
Internal loops are not taken into account by the approximative mode.
Single bulge loop effect
Model
Type Limits/Remarks Reference
tan04* DNA Tan and Chen, 2007
san04
DNA Missing closing AT penalty. SantaLucia and Hicks, 2004
ser07 RNA Less reliable results. Some Blose et al.,
2007
missing parameters.
tur06* RNA
Lu et al., 2006
* Default model for computation.
Single bulge loops are not taken into account by the approximative mode.
Long bulge loop effect
Model
Type Limits.Remarks Reference
san04* DNA Missing closing AT penalty. SantaLucia and
Hicks, 2004
tur06* RNA Not tested with experimental
Mathews et al., 1999; Lu et
results. al., 2006
*
Default model for computation.
Long bulge loops are not taken into account by the approximative mode.
CNG repeats effect
Model
Type Limits/Remarks Reference
bro05* RNA Self complementary sequences. Broda et al.,
2005
2 to 7 CNG repeats.
* Default model for
computation.
CNG repeats are not taken into account by the approximative mode. The
contribution of CNG repeats to the thermodynamic of helix-coil transition
can be computed only for 2 to 7 CNG repeats. N represents a single mismatch
of type N/N.
Inosine bases effect
Model
Type Limits/Remarks Reference
san05* DNA Missing parameters for tandem Watkins and
SantaLucia, 2005
base pairs containing inosine
bases.
zno07* RNA Only IU base pairs.
Wright et al., 2007
* Default model for computation.
Inosine bases (I) are not taken into account by the approximative mode.
Hydroxyadenine bases effect
Model
Type Limits/Remarks Reference
sug01* DNA Only 5' GA*C 3'and 5' TA*A 3' Kawakami et
al., 2001
contexts.
* Default model for computation.
Hydroxyadenine bases (A*) are not taken into account by the approximative
mode.
Azobenzenes effect effect
Model
Type Limits/Remarks Reference
asa05* DNA Less reliable results when Asanuma et al.,
2005
the number of cis azobenzene
increases.
* Default model for computation.
Azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) are not
taken into account by the approximative mode.
Single locked nucleic acids effect
Model Type Limits.Remarks
Reference
mct04 DNA McTigue, Peterson,
and Kahn,
2004
owc11* DNA
Owczarzy, You, Groth, and
Tataurov, 2011
* Default
model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the
approximative mode.
Consecutive locked nucleic acids effect
Model Type Limits.Remarks
Reference
owc11* DNA Owczarzy et al.,
2011
* Default model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the
approximative mode.
Consecutive locked nucleic acids with single mismatch
effect
Model Type
Limits.Remarks Reference
owc11*
DNA Owczarzy et al., 2011
* Default model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the
approximative mode.
Ion corrections
Sodium corrections
Correction
Type Limits.Remarks Reference
ahs01 DNA Na>0. von Ahsen et al., 2001
schlif DNA Na>=0.07; Na<=0.12. Schildkraut and
Lifson, 1965
tanna06 DNA Na>=0.001; Na<=1. Tan and
Chen, 2006
tanna07* RNA Na>=0.003; Na<=1. Tan and
Chen, 2007
or
2'-O-MeRNA/RNA
wet91 RNA, Na>0. Wetmur, 1991
DNA
and
RNA/DNA
kam71 DNA
Na>0; Na>=0.069; Na<=1.02. Frank-Kamenetskii, 1971
marschdot DNA Na>=0.069; Na<=1.02. Marmur and Doty,
1962; Blake
and Delcourt, 1998
owc1904
DNA Na>0. (equation 19) Owczarzy et al., 2004
owc2004
DNA Na>0. (equation 20) Owczarzy et al., 2004
owc2104 DNA Na>0. (equation 21) Owczarzy et al., 2004
owc2204* DNA Na>0. (equation 22) Owczarzy et al.,
2004
san96 DNA Na>=0.1. SantaLucia et al., 1996
san04 DNA Na>=0.05; Na<=1.1; SantaLucia and
Hicks, 2004;
Oligonucleotides inferior to SantaLucia,
1998
16 bases.
* Default correction method for
computation.
Magnesium corrections
Correction
Type Limits/Remarks Reference
owcmg08* DNA Mg>=0.0005; Mg<=0.6. Owczarzy et al.,
2008
tanmg06 DNA Mg>=0.0001; Mg<=1; Oligomer Tan
and Chen, 2006
length superior to 6 base
pairs.
tanmg07* RNA Mg>=0.1; Mg<=0.3. Tan and
Chen, 2007
* Default correction method for computation.
Mixed Sodium and Magnesium corrections
Correction Type Limits.Remarks
Reference
owcmix08* DNA Mg>=0.0005; Mg<=0.6;
Owczarzy et al., 2008
Na+K+Tris/2>0.
tanmix07 DNA, Mg>=0.1; Mg<=0.3; Tan and Chen, 2007
RNA Na+K+Tris/2>=0.1;
or Na+K+Tris/2<=0.3.
2'-O-MeRNA/RNA
* Default correction method for
computation.
The ion correction by Owczarzy et al. (2008) is used by default according
to the [Mg2+]0.5 ⁄
[Mon+]
ratio, where [Mon+] = [Na+]
+ [Tris+] + [K+]
.
If,
- [Mon+]
= 0
Default sodium correction is used.
- Ratio < 0.22,
Default
sodium correction is used.
- 0.22 <= Ratio < 6
Default mixed Na and
Mg correction is used.
- Ratio >= 6
Default magnesium correction is
used.
Note that
[Tris+] is
about half of the total tris buffer concentration.
Sodium equivalent concentration methods
Correction Type Limits/Remarks
Reference
ahs01* DNA von Ahsen et al.,
2001
mit96 DNA Mitsuhashi, 1996
pey00
DNA Peyret, 2000
* Default correction method for
computation.
For the other types of hybridization, the DNA default correction is used.
If there are other cations when an approximative approach is used, a sodium
equivalence is automatically computed. In case of nearest neighbor
approach, the sodium equivalence will be used only if a sodium correction
is specified by the argument correction.ion.
Denaturing agent corrections
DMSO corrections
Correction
Type Limits/Remarks Reference
ahs01* DNA Not tested with experimental von Ahsen et
al., 2001
results.
cul76 DNA Not
tested with experimental Cullen and Bick, 1976
results.
esc80 DNA Not tested with experimental Escara
and Hutton, 1980
results.
mus81 DNA
Not tested with experimental Musielski et al., 1981
results.
* Default correction method for computation.
For the other types of hybridization, the DNA default correction is used.
If there is DMSO when an approximative approach is used, a DMSO correction
is automatically computed. In case of nearest neighbor approach and
approximative approach, the DMSO correction will be used only if a sodium
correction is specified by the argument correction.ion.
Formamide corrections
Correction
Type Limits/Remarks Reference
bla96* DNA With formamide concentration Blake, 1996
in mol/L.
lincorr DNA With a
formamide volume. McConaughy et al., 1969;
Record,
1967; Casey and
Davidson, 1977; Hutton, 1977
* Default
correction method for computation.
For the other types of hybridization, the DNA default correction is used.
If there is formamide when an approximative approach is used, a formamide
correction is automatically computed. In case of nearest neighbor approach
and approximative approach, the formamide correction will be used only if a
sodium correction is specified by the argument correction.ion.
References
\insertRefmarmur_determination_1962rmelting
\insertRefschildkraut_dependence_1965rmelting
\insertRefrecord_electrostatic_1967rmelting
\insertRefmcconaughy_nucleic_1969rmelting
\insertRefowen_determination_1969rmelting
\insertReffrank-kamenetskii_simplification_1971rmelting
\insertRefbritten_analysis_1974rmelting
\insertRefcullen_thermal_1976rmelting
\insertRefhutton_renaturation_1977rmelting
\insertRefcasey_rates_1977rmelting
\insertRefhall_evolution_1980rmelting
\insertRefescara_thermal_1980rmelting
\insertRefmusielski_influence_1981rmelting
\insertReffreier_improved_1986rmelting
\insertRefbreslauer_predicting_1986rmelting
\insertRefwahl_molecular_1987rmelting
\insertRefwetmur_dna_1991rmelting
\insertRefchester_dimethyl_1993rmelting
\insertRefsugimoto_rna/dna_1994rmelting
\insertRefsugimoto_thermodynamic_1995rmelting
\insertRefsantalucia_improved_1996rmelting
\insertRefsugimoto_improved_1996rmelting
\insertRefblake_thermodynamic_1996rmelting
\insertRefblake_denaturation_1996rmelting
\insertRefmitsuhashi_technical_1996rmelting
\insertRefallawi_thermodynamics_1997rmelting
\insertRefsantalucia_unified_1998rmelting
\insertRefxia_thermodynamic_1998rmelting
\insertRefallawi_thermodynamics_1998rmelting
\insertRefblake_thermal_1998rmelting
\insertRefallawi_nearest_1998rmelting
\insertRefallawi_nearest-neighbor_1998rmelting
\insertRefmathews_expanded_1999rmelting
\insertRefpeyret_nearest-neighbor_1999rmelting
\insertRefpeyret_prediction_2000rmelting
\insertRefbommarito_thermodynamic_2000rmelting
\insertRefkawakami_thermodynamic_2001rmelting
\insertRefvon_ahsen_oligonucleotide_2001rmelting
\insertRefle_novere_melting_2001rmelting
\insertRefohmichi_long_2002rmelting
\insertRefsantalucia_thermodynamics_2004rmelting
\insertReftanaka_thermodynamic_2004rmelting
\insertRefmctigue_sequence-dependent_2004rmelting
\insertRefowczarzy_stability_2011rmelting
\insertRefowczarzy_effects_2004rmelting
\insertRefbroda_thermodynamic_2005rmelting
\insertRefwatkins_nearest-neighbor_2005rmelting
\insertRefasanuma_clear-cut_2005rmelting
\insertRefotoole_stability_2005rmelting
\insertReflu_set_2006rmelting
\insertRefkierzek_nearest_2006rmelting
\insertReftan_nucleic_2006rmelting
\insertRefotoole_comprehensive_2006rmelting
\insertReftan_rna_2007rmelting
\insertRefwright_nearest_2007rmelting
\insertRefdavis_thermodynamic_2007rmelting
\insertRefblose_non-nearest-neighbor_2007rmelting
\insertRefbadhwar_thermodynamic_2007rmelting
\insertRefdavis_thermodynamic_2008rmelting
\insertRefmiller_thermodynamic_2008rmelting
\insertRefowczarzy_predicting_2008rmelting
\insertRefwatkins_thermodynamic_2011rmelting
\insertRefchen_testing_2012rmelting
\insertRefdumousseau_melting_2012rmelting
See Also
For more details about algorithm, formulae and methods, see the
documentation for
MELTING
5.
Examples
# Basic usage
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# For more detailed examples refer the vignette.
## Not run:
browseVignettes(package = 'rmelting')
## End(Not run)
aravind-j/rmelting documentation built on May 16, 2023, 10:47 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
| melting | R Documentation |
Compute melting temperature of a nucleic acid duplex
Description
Compute the enthalpy and entropy of helix-coil transition, and then the melting temperature of a nucleic acid duplex with the MELTING 5 software (Le Novère, 2001; Dumousseau et al., 2012).
Usage
melting(sequence, comp.sequence = NULL,
nucleic.acid.conc,
hybridisation.type = c("dnadna", "rnarna", "dnarna",
"rnadna", "mrnarna", "rnamrna"),
Na.conc, Mg.conc, Tris.conc, K.conc,
dNTP.conc, DMSO.conc, formamide.conc,
size.threshold = 60, force.self = FALSE, correction.factor,
method.approx = c("ahs01", "che93", "che93corr",
"schdot", "owe69", "san98",
"wetdna91", "wetrna91", "wetdnarna91"),
method.nn = c("all97", "bre86", "san04", "san96", "sug96",
"tan04", "fre86", "xia98", "sug95", "tur06"),
method.GU = c("tur99", "ser12"),
method.singleMM = c("allsanpey", "tur06", "zno07", "zno08", "wat11"),
method.tandemMM = c("allsanpey", "tur99"),
method.single.dangle = c("bom00", "sugdna02", "sugrna02", "ser08"),
method.double.dangle = c("sugdna02", "sugrna02", "ser05", "ser06"),
method.long.dangle = c("sugdna02", "sugrna02"),
method.internal.loop = c("san04", "tur06", "zno07"),
method.single.bulge.loop = c("tan04", "san04", "ser07" ,"tur06"),
method.long.bulge.loop = c("san04", "tur06"),
method.CNG = c("bro05"),
method.inosine = c("san05", "zno07"),
method.hydroxyadenine = c("sug01"),
method.azobenzenes = c("asa05"),
method.locked = c("owc11", "mct04"),
method.consecutive.locked = c("owc11"),
method.consecutive.locked.singleMM = c("owc11"),
correction.ion = c("ahs01", "kam71", "marschdot",
"owc1904", "owc2004", "owc2104",
"owc2204", "san96", "san04", "schlif",
"tanna06", "tanna07", "wet91",
"owcmg08", "tanmg06", "tanmg07",
"owcmix08", "tanmix07"),
method.Naeq = c("ahs01", "mit96", "pey00"),
correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
correction.formamide = c("bla96", "lincorr"))
Arguments
sequence |
Sequence (5' to 3') of one strand of the nucleic acid duplex as a character string (Note: Uridine and thymidine are not considered as identical). |
comp.sequence |
Complementary sequence (3' to 5') of the nucleic acid duplex as a character string. |
nucleic.acid.conc |
Concentration of the nucleic acid strand (M or mol L-1) in excess as a numeric value. |
hybridisation.type |
The hybridisation type. Either |
Na.conc |
Concentration of Na ions (M) as a positive numeric value (see Ion and agent concentrations). |
Mg.conc |
Concentration of Mg ions (M) as a positive numeric value (see Ion and agent concentrations). |
Tris.conc |
Concentration of Tris ions (M) as a positive numeric value (see Ion and agent concentrations). |
K.conc |
Concentration of K ions (M) as a positive numeric value (see Ion and agent concentrations). |
dNTP.conc |
Concentration of dNTP (M) as a positive numeric value (see Ion and agent concentrations). |
DMSO.conc |
Concentration of DMSO (%) as a positive numeric value (see Ion and agent concentrations). |
formamide.conc |
Concentration of formamide (M or % depending on correction method) as a positive numeric value (see Ion and agent concentrations). |
size.threshold |
Sequence length threshold to decide approximative or nearest-neighbour approach for computation. Default is 60. |
force.self |
logical. Enforces that |
correction.factor |
Correction factor to be used to modulate the effect
of the nucleic acid concentration ( |
method.approx |
Specify the approximative formula to be used for melting
temperature calculation for sequences of length greater than
|
method.nn |
Specify the nearest neighbor model to be used for melting
temperature calculation for perfectly matching sequences of length lesser
than |
method.GU |
Specify the nearest neighbor model to compute the
contribution of GU base pairs to the thermodynamic of helix-coil
transition. Either |
method.singleMM |
Specify the nearest neighbor model to compute the
contribution of single mismatch to the thermodynamic of helix-coil
transition. Either |
method.tandemMM |
Specify the nearest neighbor model to compute the
contribution of tandem mismatches to the thermodynamic of helix-coil
transition. Either |
method.single.dangle |
Specify the nearest neighbor model to compute the
contribution of single dangling end to the thermodynamic of helix-coil
transition. Either |
method.double.dangle |
Specify the nearest neighbor model to compute the
contribution of double dangling end to the thermodynamic of helix-coil
transition. Either |
method.long.dangle |
Specify the nearest neighbor model to compute the
contribution of long dangling end to the thermodynamic of helix-coil
transition. Either |
method.internal.loop |
Specify the nearest neighbor model to compute the
contribution of internal loop to the thermodynamic of helix-coil
transition. Either |
method.single.bulge.loop |
Specify the nearest neighbor model to compute
the contribution of single bulge loop to the thermodynamic of helix-coil
transition. Either |
method.long.bulge.loop |
Specify the nearest neighbor model to compute
the contribution of long bulge loop to the thermodynamic of helix-coil
transition. Either |
method.CNG |
Specify the nearest neighbor model to compute the
contribution of CNG repeats to the thermodynamic of helix-coil transition.
Available method is |
method.inosine |
Specify the specific nearest neighbor model to compute
the contribution of inosine bases (I) to the thermodynamic of helix-coil
transition. Either |
method.hydroxyadenine |
Specify the nearest neighbor model to compute
the contribution of hydroxyadenine bases (A*) to the thermodynamic of
helix-coil transition. Available method is |
method.azobenzenes |
Specify the nearest neighbor model to compute the
contribution of azobenzenes (X_T for trans azobenzenes and X_C for cis
azobenzenes) to the thermodynamic of helix-coil transition. Available
method is |
method.locked |
Specify the nearest neighbor model to compute the
contribution of single locked nucleic acids (AL, GL, TL and CL) to the
thermodynamic of helix-coil transition. Either |
method.consecutive.locked |
Specify the nearest neighbor model to
compute the contribution of consecutive locked nucleic acids (AL, GL, TL
and CL) to the thermodynamic of helix-coil transition. Available
method is |
method.consecutive.locked.singleMM |
Specify the nearest neighbor model
to compute the contribution of consecutive locked nucleic acids (AL, GL, TL
and CL) with a single mismatch to the thermodynamic of helix-coil
transition. Available method is |
correction.ion |
Specify the correction method for ions. Either one of the following:
. |
method.Naeq |
Specify the ion correction which gives a sodium equivalent
concentration if other cations are present. Either |
correction.DMSO |
Specify the correction method for DMSO. Specify the
correction method for DMSO. Either |
correction.formamide |
Specify the correction method for formamide.
Specify the correction method for formamide Either |
Value
A list with the following components:
Environment |
A list with details about the melting temperature computation environment. |
Options |
A list with details about the options (default or user specified) used for melting temperature computation. |
Results |
A list with the results of the melting temperature computation including the enthalpy and entropy in case of nearest neighbour methods. |
Message |
Error and/or Warning messages, if any. |
Mandatory arguments
The following are the arguments which are mandatory for computation.
sequence5' to 3' sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL. U and T are not considered identical (see Recognized nucleotides).
comp.sequenceMandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of
sequence. Self-complementarity insequenceis detected even though there may be (are) dangling end(s) andcomp.sequenceis computed (see Self complementary sequences).nucleic.acid.concSee Correction factor for nucleic acid concentration.
Na.conc, Mg.conc, Tris.conc, K.concAt least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional (see Ion and agent concentrations).
hybridisation.typeSee Hybridisation type options.
Recognized nucleotides
| Code | Type |
| A | Adenine |
| C | Cytosine |
| G | Guanine |
| T | Thymine |
| U | Uracil |
| I | Inosine |
| X_C | Trans azobenzenes |
| X_T | Cis azobenzenes |
| A* | Hydroxyadenine |
| AL | Locked nucleic acid |
| TL | " |
| GL | " |
| CL | " |
U and T are not considered identical.
Hybridisation type options
The details of the possible options for
hybridisation type specified in the argument hybridisation.type are
as follows:
| Option | Sequence |
Complementary sequence |
dnadna | DNA | DNA |
rnarna | RNA | RNA |
dnarna | DNA | RNA |
rnadna | RNA | DNA |
mrnarna | 2-o-methyl RNA | RNA |
rnamrna | RNA | 2-o-methyl RNA |
This parameter determines the nature of the sequences in the arguments
sequence and comp.sequence.
Ion and agent concentrations
Ion concentrations are specified by
the arguments Na.conc, Mg.conc, Tris.conc and
K.conc, while agent concentrations are specified by the arguments
dNTP.conc, DMSO.conc and formamide.conc.
These values are used for different correction functions which approximately adjusts for effects of these ions (Na, Mg, Tris, K) and/or agents (dNTP, DMSO, formamide) on on thermodynamic stability of nucleic acid duplexes. Their concentration limits depends on the correction method used. All the concentrations must be in M, except for the DMSO (%) and formamide (% or M depending on the correction method). Note that [Tris+] is about half of the total tris buffer concentration.
Self complementary sequences
Self complementarity for perfect
matching sequences or sequences with dangling ends is detected
automatically. However it can be enforced by the argument force.self
= TRUE.
Correction factor for nucleic acid concentration
For self
complementary sequences (Auto detected or specified by force.self)
it is 1. Otherwise it is 4 if the both strands are present in equivalent
amount and 1 if one strand is in excess.
Approximative estimation formulas
| Formula | Type | Limits/Remarks | Reference |
ahs01 | DNA | No mismatch | von Ahsen et al., 2001 |
che93 | DNA | No mismatch; Na=0, Mg=0.0015, | Marmur and Doty, 1962 |
| Tris=0.01, K=0.05 | |||
che93corr | DNA | No mismatch; Na=0, Mg=0.0015, | Marmur and Doty, 1962 |
| Tris=0.01, K=0.05 | |||
schdot | DNA | No mismatch | Wetmur, 1991; Marmur and |
| Doty, 1962; Chester and | |||
| Marshak, 1993; Schildkraut | |||
| and Lifson, 1965; Wahl et | |||
| al., 1987; Britten et al., | |||
| 1974; Hall et al., 1980 | |||
owe69 | DNA | No mismatch | Owen et al., 1969; |
| Frank-Kamenetskii, 1971; | |||
| Blake, 1996; Blake and | |||
| Delcourt, 1998 | |||
san98 | DNA | No mismatch | SantaLucia, 1998; von Ahsen |
| et al., 2001 | |||
wetdna91* | DNA | Wetmur, 1991 | |
wetrna91* | RNA | Wetmur, 1991 | |
wetdnarna91* | DNA/RNA | Wetmur, 1991 |
* Default formula for computation.
Note that calculation is increasingly incorrect when the length of the duplex decreases. Further, it does not take into account nucleic acid concentration.
Nearest neighbor models
Perfectly matching sequences
| Model | Type | Limits/Remarks | Reference |
all97* | DNA | Allawi and SantaLucia, 1997 | |
tur06* | 2'-O-MeRNA/ | A sodium correction | Kierzek et al., 2006 |
| RNA | (san04) is | ||
| automatically applied to | |||
| convert the entropy (Na = | |||
| 0.1M) into the entropy (Na = | |||
| 1M). | |||
bre86
| DNA | Breslauer et al., 1986 | |
san04 | DNA | SantaLucia and Hicks, 2004 | |
san96 | DNA | SantaLucia et al., 1996 | |
sug96 | DNA | Sugimoto et al., 1996 | |
tan04 | DNA | Tanaka et al., 2004 | |
fre86 | RNA | Freier et al., 1986 | |
xia98* | RNA | Xia et al., 1998 | |
sug95* | DNA/ | SantaLucia et al., 1996 | |
| RNA |
* Default model for computation.
GU wobble base pairs effect
| Model | Type | Limits/Remarks | Reference |
tur99 | RNA | Mathews et al., 1999 | |
ser12* | RNA | Chen et al., 2012 |
* Default model for computation.
GU base pairs are not taken into account by the approximative mode.
Single mismatch effect
| Model | Type | Limits.Remarks | Reference |
allsanpey* | DNA | Allawi and SantaLucia, 1997; | |
| Allawi and SantaLucia, 1998; | |||
| Allawi and SantaLucia, 1998; | |||
| Allawi and SantaLucia, 1998; | |||
| Peyret et al., 1999 | |||
wat11* | DNA/RNA | Watkins et al., 2011 | |
tur06 | RNA | Lu et al., 2006 | |
zno07* | RNA | Davis and Znosko, 2007 | |
zno08 | RNA | At least one adjacent GU base | Davis and Znosko, 2008 |
| pair. |
* Default model for computation.
Single mismatches are not taken into account by the approximative mode.
Tandem mismatches effect
| Model | Type | Limits.Remarks | Reference |
allsanpey* | DNA | Only GT mismatches and TA/TG | Allawi and SantaLucia, 1997; |
| mismatches. | Allawi and SantaLucia, 1998; | ||
| Allawi and SantaLucia, 1998; | |||
| Allawi and SantaLucia, 1998; | |||
| Peyret et al., 1999 | |||
tur99* | RNA | No adjacent GU or UG base | Mathews et al., 1999; Lu et |
| pairs. | al., 2006 |
* Default model for computation.
Tandem mismatches are not taken into account by the approximative mode. Note that not all the mismatched Crick's pairs have been investigated.
Single dangling end effect
| Model | Type | Limits.Remarks | Reference |
bom00* | DNA | Bommarito et al., 2000 | |
sugdna02
| DNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. | |||
sugrna02 | RNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. | |||
ser08* | RNA | Only 3' UA, GU and UG | O'Toole et al., 2006; Miller |
| terminal base pairs only 5' | et al., 2008 | ||
| UG and GU terminal base | |||
| pairs. |
* Default model for computation.
Single dangling ends are not taken into account by the approximative mode.
Double dangling end effect
| Model | Type | Limits/Remarks | Reference |
sugdna02* | DNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. | |||
sugrna02 | RNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. | |||
ser05 | RNA | Depends on the available | O'Toole et al., 2005 |
| thermodynamic parameters for | |||
| single dangling end. | |||
ser06* | RNA | O'Toole et al., 2006 |
* Default model for computation.
Double dangling ends are not taken into account by the approximative mode.
Long dangling end effect
| Model | Type | Limits/Remarks | Reference |
sugdna02* | DNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. | |||
sugrna02*
| RNA | Only terminal poly A self | Ohmichi et al., 2002 |
| complementary sequences. |
* Default model for computation.
Long dangling ends are not taken into account by the approximative mode.
Internal loop effect
| Model | Type | Limits.Remarks | Reference |
san04* | DNA | Missing asymmetry penalty. | SantaLucia and Hicks, 2004 |
| Not tested with experimental | |||
| results. | |||
tur06 | RNA | Not tested with experimental | Lu et al., 2006 |
| results. | |||
zno07* | RNA | Only for 1x2 loop. | Badhwar et al., 2007 |
* Default model for computation.
Internal loops are not taken into account by the approximative mode.
Single bulge loop effect
| Model | Type | Limits/Remarks | Reference |
tan04* | DNA | Tan and Chen, 2007 | |
san04 | DNA | Missing closing AT penalty. | SantaLucia and Hicks, 2004 |
ser07 | RNA | Less reliable results. Some | Blose et al., 2007 |
| missing parameters. | |||
tur06* | RNA | Lu et al., 2006 |
* Default model for computation.
Single bulge loops are not taken into account by the approximative mode.
Long bulge loop effect
| Model | Type | Limits.Remarks | Reference |
san04* | DNA | Missing closing AT penalty. | SantaLucia and Hicks, 2004 |
tur06* | RNA | Not tested with experimental | Mathews et al., 1999; Lu et |
| results. | al., 2006 |
* Default model for computation.
Long bulge loops are not taken into account by the approximative mode.
CNG repeats effect
| Model | Type | Limits/Remarks | Reference |
bro05* | RNA | Self complementary sequences. | Broda et al., 2005 |
| 2 to 7 CNG repeats. |
* Default model for computation.
CNG repeats are not taken into account by the approximative mode. The contribution of CNG repeats to the thermodynamic of helix-coil transition can be computed only for 2 to 7 CNG repeats. N represents a single mismatch of type N/N.
Inosine bases effect
| Model | Type | Limits/Remarks | Reference |
san05* | DNA | Missing parameters for tandem | Watkins and SantaLucia, 2005 |
| base pairs containing inosine | |||
| bases. | |||
zno07* | RNA | Only IU base pairs. | Wright et al., 2007 |
* Default model for computation.
Inosine bases (I) are not taken into account by the approximative mode.
Hydroxyadenine bases effect
| Model | Type | Limits/Remarks | Reference |
sug01* | DNA | Only 5' GA*C 3'and 5' TA*A 3' | Kawakami et al., 2001 |
| contexts. |
* Default model for computation.
Hydroxyadenine bases (A*) are not taken into account by the approximative mode.
Azobenzenes effect effect
| Model | Type | Limits/Remarks | Reference |
asa05* | DNA | Less reliable results when | Asanuma et al., 2005 |
| the number of cis azobenzene | |||
| increases. |
* Default model for computation.
Azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) are not taken into account by the approximative mode.
Single locked nucleic acids effect
| Model | Type | Limits.Remarks | Reference |
mct04 | DNA | McTigue, Peterson, and Kahn, | |
| 2004 | |||
owc11* | DNA | Owczarzy, You, Groth, and | |
| Tataurov, 2011 |
* Default model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.
Consecutive locked nucleic acids effect
| Model | Type | Limits.Remarks | Reference |
owc11* | DNA | Owczarzy et al., 2011 |
* Default model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.
Consecutive locked nucleic acids with single mismatch effect
| Model | Type | Limits.Remarks | Reference |
owc11* | DNA | Owczarzy et al., 2011 |
* Default model for computation.
Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.
Ion corrections
Sodium corrections
| Correction | Type | Limits.Remarks | Reference |
ahs01 | DNA | Na>0. | von Ahsen et al., 2001 |
schlif | DNA | Na>=0.07; Na<=0.12. | Schildkraut and Lifson, 1965 |
tanna06 | DNA | Na>=0.001; Na<=1. | Tan and Chen, 2006 |
tanna07* | RNA | Na>=0.003; Na<=1. | Tan and Chen, 2007 |
| or | |||
| 2'-O-MeRNA/RNA | |||
wet91 | RNA, | Na>0. | Wetmur, 1991 |
| DNA | |||
| and | |||
| RNA/DNA | |||
kam71 | DNA | Na>0; Na>=0.069; Na<=1.02. | Frank-Kamenetskii, 1971 |
marschdot | DNA | Na>=0.069; Na<=1.02. | Marmur and Doty, 1962; Blake |
| and Delcourt, 1998 | |||
owc1904 | DNA | Na>0. (equation 19) | Owczarzy et al., 2004 |
owc2004
| DNA | Na>0. (equation 20) | Owczarzy et al., 2004 |
owc2104 | DNA | Na>0. (equation 21) | Owczarzy et al., 2004 |
owc2204* | DNA | Na>0. (equation 22) | Owczarzy et al., 2004 |
san96 | DNA | Na>=0.1. | SantaLucia et al., 1996 |
san04 | DNA | Na>=0.05; Na<=1.1; | SantaLucia and Hicks, 2004; |
| Oligonucleotides inferior to | SantaLucia, 1998 | ||
| 16 bases. |
* Default correction method for computation.
Magnesium corrections
| Correction | Type | Limits/Remarks | Reference |
owcmg08* | DNA | Mg>=0.0005; Mg<=0.6. | Owczarzy et al., 2008 |
tanmg06 | DNA | Mg>=0.0001; Mg<=1; Oligomer | Tan and Chen, 2006 |
| length superior to 6 base | |||
| pairs. | |||
tanmg07* | RNA | Mg>=0.1; Mg<=0.3. | Tan and Chen, 2007 |
* Default correction method for computation.
Mixed Sodium and Magnesium corrections
| Correction | Type | Limits.Remarks | Reference |
owcmix08* | DNA | Mg>=0.0005; Mg<=0.6; | Owczarzy et al., 2008 |
| Na+K+Tris/2>0. | |||
tanmix07 | DNA, | Mg>=0.1; Mg<=0.3; | Tan and Chen, 2007 |
| RNA | Na+K+Tris/2>=0.1; | ||
| or | Na+K+Tris/2<=0.3. | ||
| 2'-O-MeRNA/RNA |
* Default correction method for computation.
The ion correction by Owczarzy et al. (2008) is used by default according to the [Mg2+]0.5 ⁄ [Mon+] ratio, where [Mon+] = [Na+] + [Tris+] + [K+] .
If,
- [Mon+] = 0
Default sodium correction is used.
- Ratio < 0.22,
Default sodium correction is used.
- 0.22 <= Ratio < 6
Default mixed Na and Mg correction is used.
- Ratio >= 6
Default magnesium correction is used.
Note that [Tris+] is about half of the total tris buffer concentration.
Sodium equivalent concentration methods
| Correction | Type | Limits/Remarks | Reference |
ahs01* | DNA | von Ahsen et al., 2001 | |
mit96 | DNA | Mitsuhashi, 1996 | |
pey00
| DNA | Peyret, 2000 |
* Default correction method for computation.
For the other types of hybridization, the DNA default correction is used.
If there are other cations when an approximative approach is used, a sodium
equivalence is automatically computed. In case of nearest neighbor
approach, the sodium equivalence will be used only if a sodium correction
is specified by the argument correction.ion.
Denaturing agent corrections
DMSO corrections
| Correction | Type | Limits/Remarks | Reference |
ahs01* | DNA | Not tested with experimental | von Ahsen et al., 2001 |
| results. | |||
cul76 | DNA | Not tested with experimental | Cullen and Bick, 1976 |
| results. | |||
esc80 | DNA | Not tested with experimental | Escara and Hutton, 1980 |
| results. | |||
mus81 | DNA | Not tested with experimental | Musielski et al., 1981 |
| results. |
* Default correction method for computation.
For the other types of hybridization, the DNA default correction is used.
If there is DMSO when an approximative approach is used, a DMSO correction
is automatically computed. In case of nearest neighbor approach and
approximative approach, the DMSO correction will be used only if a sodium
correction is specified by the argument correction.ion.
Formamide corrections
| Correction | Type | Limits/Remarks | Reference |
bla96* | DNA | With formamide concentration | Blake, 1996 |
| in mol/L. | |||
lincorr | DNA | With a formamide volume. | McConaughy et al., 1969; |
| Record, 1967; Casey and | |||
| Davidson, 1977; Hutton, 1977 |
* Default correction method for computation.
For the other types of hybridization, the DNA default correction is used.
If there is formamide when an approximative approach is used, a formamide
correction is automatically computed. In case of nearest neighbor approach
and approximative approach, the formamide correction will be used only if a
sodium correction is specified by the argument correction.ion.
References
\insertRefmarmur_determination_1962rmelting
\insertRefschildkraut_dependence_1965rmelting
\insertRefrecord_electrostatic_1967rmelting
\insertRefmcconaughy_nucleic_1969rmelting
\insertRefowen_determination_1969rmelting
\insertReffrank-kamenetskii_simplification_1971rmelting
\insertRefbritten_analysis_1974rmelting
\insertRefcullen_thermal_1976rmelting
\insertRefhutton_renaturation_1977rmelting
\insertRefcasey_rates_1977rmelting
\insertRefhall_evolution_1980rmelting
\insertRefescara_thermal_1980rmelting
\insertRefmusielski_influence_1981rmelting
\insertReffreier_improved_1986rmelting
\insertRefbreslauer_predicting_1986rmelting
\insertRefwahl_molecular_1987rmelting
\insertRefwetmur_dna_1991rmelting
\insertRefchester_dimethyl_1993rmelting
\insertRefsugimoto_rna/dna_1994rmelting
\insertRefsugimoto_thermodynamic_1995rmelting
\insertRefsantalucia_improved_1996rmelting
\insertRefsugimoto_improved_1996rmelting
\insertRefblake_thermodynamic_1996rmelting
\insertRefblake_denaturation_1996rmelting
\insertRefmitsuhashi_technical_1996rmelting
\insertRefallawi_thermodynamics_1997rmelting
\insertRefsantalucia_unified_1998rmelting
\insertRefxia_thermodynamic_1998rmelting
\insertRefallawi_thermodynamics_1998rmelting
\insertRefblake_thermal_1998rmelting
\insertRefallawi_nearest_1998rmelting
\insertRefallawi_nearest-neighbor_1998rmelting
\insertRefmathews_expanded_1999rmelting
\insertRefpeyret_nearest-neighbor_1999rmelting
\insertRefpeyret_prediction_2000rmelting
\insertRefbommarito_thermodynamic_2000rmelting
\insertRefkawakami_thermodynamic_2001rmelting
\insertRefvon_ahsen_oligonucleotide_2001rmelting
\insertRefle_novere_melting_2001rmelting
\insertRefohmichi_long_2002rmelting
\insertRefsantalucia_thermodynamics_2004rmelting
\insertReftanaka_thermodynamic_2004rmelting
\insertRefmctigue_sequence-dependent_2004rmelting
\insertRefowczarzy_stability_2011rmelting
\insertRefowczarzy_effects_2004rmelting
\insertRefbroda_thermodynamic_2005rmelting
\insertRefwatkins_nearest-neighbor_2005rmelting
\insertRefasanuma_clear-cut_2005rmelting
\insertRefotoole_stability_2005rmelting
\insertReflu_set_2006rmelting
\insertRefkierzek_nearest_2006rmelting
\insertReftan_nucleic_2006rmelting
\insertRefotoole_comprehensive_2006rmelting
\insertReftan_rna_2007rmelting
\insertRefwright_nearest_2007rmelting
\insertRefdavis_thermodynamic_2007rmelting
\insertRefblose_non-nearest-neighbor_2007rmelting
\insertRefbadhwar_thermodynamic_2007rmelting
\insertRefdavis_thermodynamic_2008rmelting
\insertRefmiller_thermodynamic_2008rmelting
\insertRefowczarzy_predicting_2008rmelting
\insertRefwatkins_thermodynamic_2011rmelting
\insertRefchen_testing_2012rmelting
\insertRefdumousseau_melting_2012rmelting
See Also
For more details about algorithm, formulae and methods, see the documentation for MELTING 5.
Examples
# Basic usage
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# For more detailed examples refer the vignette.
## Not run:
browseVignettes(package = 'rmelting')
## End(Not run)
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.