| read.fasta | R Documentation | 
Read and convert the fasta file to data frame
read.fasta(file = NULL, clean_name = FALSE)
| file | character string representing the name of the fasta file. | 
| clean_name | logical, representing cleaning of the names will be performed. Punctuation characters and white space be replaced by "_" . See  | 
In this function, names of the sequences are identified by ">", and all the lines before next ">" will be concatenated.
a data frame with two columns: (1) seq.name, the names for all the sequences. (2) seq.text, the raw sequence data.
Punctuation characters and white space in the names of the sequences will be replaced by "_".
Jinlong Zhang <jinlongzhang01@gmail.com>
http://www.genomatix.de/online_help/help/sequence_formats.html
read.phylip,dat2fasta,dat2phylip,split_dat
cat(
">seq_2", "GTCTTATAAGAAAGAATAAGAAAG--AAATACAAA-------AAAAAAGA",
">seq_3", "GTCTTATAAGAAAGAAATAGAAAAGTAAAAAAAAA-------AAAAAAAG",
">seq_5", "GACATAAGACATAAAATAGAATACTCAATCAGAAACCAACCCATAAAAAC",
">seq_8", "ATTCCAAAATAAAATACAAAAAGAAAAAACTAGAAAGTTTTTTTTCTTTG",
">seq_9", "ATTCTTTGTTCTTTTTTTTCTTTAATCTTTAAATAAACCTTTTTTTTTTA",
file = "trn1.fasta", sep = "\n")
res <- read.fasta("trn1.fasta")
unlink("trn1.fasta")
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.