An R package wrapper for MELTING 5 jars.
The ‘MELTING 5’ ‘Java’ archive file is included along with the model data directory to facilitate accessing the library computations from within an R session.
You can install melting5jars
from github with:
# install.packages("devtools")
devtools::install_github("hrbrmstr/melting5jars")
This is an example made for the SO question that caused the creation of the package:
It is designed to (lightly) mimic the functionality of
melting/Main.java
Here’s melting/Main.java
:
package melting;
import java.text.NumberFormat;
import melting.configuration.OptionManagement;
import melting.configuration.RegisterMethods;
import melting.methodInterfaces.MeltingComputationMethod;
import melting.nearestNeighborModel.NearestNeighborMode;
/**
* The Melting main class which contains the public static void main(String[] args) method.
*/
public class Main {
// private static methods
/**
* Compute the entropy, enthalpy and the melting temperature and display the results.
* @param args : contains the options entered by the user.
* @param OptionManagement optionManager : the OptionManegement which allows to manage
* the different options entered by the user.
*/
private static ThermoResult runMelting(String [] args, OptionManagement optionManager){
try {
ThermoResult results =
getMeltingResults(args, optionManager);
displaysMeltingResults(results);
return results;
} catch (Exception e) {
OptionManagement.logError(e.getMessage());
return null;
}
}
/**
* Compute the entropy, enthalpy and melting temperature, and return
* these results.
* @param args options (entered by the user) that determine the
* sequence, hybridization type and other features of the
* environment.
* @param optionManager the {@link
* melting.configuration.OptionManagement
* <code>OptionManagement</code>} which
* allows the program to manage the different
* options entered by the user.
* @return The results of the Melting computation.
*/
public static ThermoResult getMeltingResults(String[] args,
OptionManagement optionManager)
{
NumberFormat format = NumberFormat.getInstance();
format.setMaximumFractionDigits(2);
// Set up the environment from the supplied arguments and get the
// results.
Environment environment = optionManager.createEnvironment(args);
RegisterMethods register = new RegisterMethods();
MeltingComputationMethod calculMethod =
register.getMeltingComputationMethod(environment.getOptions());
ThermoResult results = calculMethod.computesThermodynamics();
results.setCalculMethod(calculMethod);
environment.setResult(results);
// Apply corrections to the results.
results = calculMethod.getRegister().
computeOtherMeltingCorrections(environment);
environment.setResult(results);
return environment.getResult();
}
/**
* displays the results of Melting : the computed enthalpy and entropy (in cal/mol and J/mol), and the computed
* melting temperature (in degrees).
* @param results : the ThermoResult containing the computed enthalpy, entropy and
* melting temperature
* @param MeltingComputationMethod calculMethod : the melting computation method (Approximative or nearest neighbor computation)
*/
private static void displaysMeltingResults(ThermoResult results)
{
NumberFormat format = NumberFormat.getInstance();
format.setMaximumFractionDigits(2);
MeltingComputationMethod calculMethod =
results.getCalculMethod();
double enthalpy = results.getEnthalpy();
double entropy = results.getEntropy();
OptionManagement.logInfo("\n The MELTING results are : ");
if (calculMethod instanceof NearestNeighborMode){
OptionManagement.logInfo("Enthalpy : " + format.format(enthalpy) + " cal/mol ( " + format.format(results.getEnergyValueInJ(enthalpy)) + " J /mol)");
OptionManagement.logInfo("Entropy : " + format.format(entropy) + " cal/mol-K ( " + format.format(results.getEnergyValueInJ(entropy)) + " J /mol-K)");
}
OptionManagement.logInfo("Melting temperature : " + format.format(results.getTm()) + " degrees C.\n");
}
// public static main method
/**
* @param args : contains the options entered by the user.
*/
public static void main(String[] args) {
OptionManagement optionManager = new OptionManagement();
if (args.length == 0){
optionManager.initialiseLogger();
optionManager.readMeltingHelp();
}
else if (optionManager.isMeltingInformationOption(args)){
try {
optionManager.readOptions(args);
} catch (Exception e) {
OptionManagement.logError(e.getMessage());
}
}
else {
runMelting(args, optionManager);
}
}
}
and, here’s a light wrapper for it:
get_melting_results <- function(opts = c()) {
stopifnot(length(opts) > 2) # a sanity check that could be improved
Sys.setenv("NN_PATH"=system.file("extdata", "Data", package="melting5jars"))
require(melting5jars)
melting <- new(J("melting.Main"))
optionManager <- new(J("melting.configuration.OptionManagement"))
results <- melting$getMeltingResults(opts, optionManager)
calculMethod <- results$getCalculMethod()
enthalpy_cal <- results$getEnthalpy()
entropy_cal <- results$getEntropy()
enthalpy_J <- entropy_J <- NULL
if (.jinstanceof(calculMethod, J("melting.nearestNeighborModel.NearestNeighborMode"))) {
enthalpy_J <- results$getEnergyValueInJ(enthalpy_cal)
entropy_J <- results$getEnergyValueInJ(entropy_cal)
}
melting_temp_C <- results$getTm()
list(
enthalpy_cal = enthalpy_cal,
entropy_cal = entropy_cal,
enthalpy_J = enthalpy_J,
entropy_J = entropy_J,
melting_temp_C = melting_temp_C
) -> out
class(out) <- c("melting_res")
out
}
print.melting_res <- function(x, ...) {
cat(
"The MELTING results are:\n\n",
" - Enthalpy: ", prettyNum(x$enthalpy_cal), " cal/mol",
{if (!is.null(x$enthalpy_J)) paste0(" (", prettyNum(x$enthalpy_J), " J /mol)", collapse="") else ""}, "\n",
" - Entropy: ", prettyNum(x$entropy_cal), " cal/mol-K",
{if (!is.null(x$entropy_J)) paste0(" (", prettyNum(x$entropy_J), " J /mol-K)", collapse="") else ""}, "\n",
" - Meltng temperature: ", prettyNum(x$melting_temp_C), " degress C\n",
sep=""
)
}
Sodium <- 0.05
opts <- c(
"-S", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCCAC",
"-H", "dnadna",
"-P", 5e-8,
"-E", paste("Na=", Sodium, sep = "")
)
res <- get_melting_results(opts)
#> Loading required package: melting5jars
#> Loading required package: rJava
res
#> The MELTING results are:
#>
#> - Enthalpy: -408000 cal/mol (-1705440 J /mol)
#> - Entropy: -1092.4 cal/mol-K (-4566.232 J /mol-K)
#> - Meltng temperature: 72.04301 degress C
str(res)
#> List of 5
#> $ enthalpy_cal : num -408000
#> $ entropy_cal : num -1092
#> $ enthalpy_J : num -1705440
#> $ entropy_J : num -4566
#> $ melting_temp_C: num 72
#> - attr(*, "class")= chr "melting_res"
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.