README.md

In rforbiodatascience22/group_1_package: replicate the central dogma of molecular biology

The biocentral package for all your central dogma needs

Group 1

• Danli Shen (s185387)

• Dave Rojas (s212767)

• Mathias N. Stokholm (s184257)

• Ziyu Zhang (s212657)

• Karolina Krzesińska (s212842)

The biocentral R package contains functions pertaining to the central dogma including transcription and translation. The package also contains functions to synthesise DNA and measure amino acid frequency in a peptide.

First the package is installed and loaded.

if (!require("biocentral", quietly = TRUE))
    devtools::install_github("rforbiodatascience22/group_1_package")
library(biocentral)

Transcription

To transcribe a DNA sequence we first need to synthesise our DNA with the createdna function.

set.seed(123)
DNAseq <- createdna(30)
DNAseq
#> [1] "GGGTGTTTGACTTATGCAGGACAAAGCTGT"

Next, the DNA sequence is transcribed using the dna_to_rna function.

RNAseq <- dna_to_rna(DNAseq)
RNAseq
#> [1] "GGGUGUUUGACUUAUGCAGGACAAAGCUGU"

Translation

Next, insert the RNA sequence in the codon_start function to split the sequence to codons. Here we start at position 1, but other reading frames can be used by changing the start position.

codons <- codon_start(RNAseq, start = 1)
codons
#>  [1] "GGG" "UGU" "UUG" "ACU" "UAU" "GCA" "GGA" "CAA" "AGC" "UGU"

Translation is done with the codon2amino function.

aa <- codon2amino(codons)
aa
#> [1] "GCLTYAGQSC"

Amino Acid Frequency

To determine the amino acid frequency, the seq_count function is used. This function will create a bar plot showing the amino acid frequency. It will only show the amino acids that appear at least once in the sequence.

seq_count(seq = aa)

rforbiodatascience22/group_1_package documentation built on April 5, 2022, 7:51 p.m.