library("traits")
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax")) #> # A tibble: 14 x 36 #> checked result_type id citation_id site_id treatment_id sitename city #> <int> <chr> <int> <int> <int> <int> <chr> <chr> #> 1 1 traits 39217 430 645 1342 "" Saare #> 2 1 traits 39218 430 645 1343 "" Saare #> 3 1 traits 39219 430 645 1344 "" Saare #> 4 1 traits 39220 430 645 1345 "" Saare #> 5 1 traits 25405 51 NA 1 <NA> <NA> #> 6 1 traits 39213 430 645 1342 "" Saare #> 7 1 traits 39214 430 645 1343 "" Saare #> 8 1 traits 39215 430 645 1344 "" Saare #> 9 1 traits 39216 430 645 1345 "" Saare #> 10 1 traits 39221 430 645 1342 "" Saare #> 11 1 traits 39222 430 645 1343 "" Saare #> 12 1 traits 39223 430 645 1344 "" Saare #> 13 1 traits 39224 430 645 1345 "" Saare #> 14 1 traits 37519 381 602 1220 <NA> <NA> #> # … with 28 more variables: lat <dbl>, lon <dbl>, scientificname <chr>, #> # commonname <chr>, genus <chr>, species_id <int>, cultivar_id <int>, #> # author <chr>, citation_year <int>, treatment <chr>, date <chr>, time <chr>, #> # raw_date <chr>, month <int>, year <int>, dateloc <chr>, trait <chr>, #> # trait_description <chr>, mean <dbl>, units <chr>, n <int>, statname <chr>, #> # stat <dbl>, notes <chr>, access_level <int>, cultivar <chr>, entity <lgl>, #> # method_name <lgl> # equivalent: # (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr") salix %>% group_by(scientificname, trait) %>% mutate(.mean = as.numeric(mean)) %>% summarise(mean = round(mean(.mean, na.rm = TRUE), 2), min = round(min(.mean, na.rm = TRUE), 2), max = round(max(.mean, na.rm = TRUE), 2), n = length(n)) #> # A tibble: 4 x 6 #> # Groups: scientificname [4] #> scientificname trait mean min max n #> <chr> <chr> <dbl> <dbl> <dbl> <int> #> 1 Salix Vcmax 65 65 65 1 #> 2 Salix dasyclados Vcmax 46.1 34.3 56.7 4 #> 3 Salix sachalinensis × miyabeana Vcmax 79.3 79.3 79.3 1 #> 4 Salix viminalis Vcmax 43.0 20.0 61.3 8
Get sequences by id
ncbi_byid(ids = "360040093") #> taxon #> 1 Eristalis transversa #> taxonomy #> 1 Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Holometabola; Diptera; Brachycera; Muscomorpha; Syrphoidea; Syrphidae; Eristalinae; Eristalini; Eristalis #> gene_desc #> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial #> organelle gi_no acc_no keyword specimen_voucher #> 1 mitochondrion 360040093 JN991986.1 BARCODE CNC:Diptera:102013 #> lat_lon #> 1 38.4623 N 79.2417 W #> country #> 1 USA: Virginia, Reddish Knob Lookout, 14.5km W Briery Branch #> paper_title #> 1 The evolution of imperfect mimicry in hover flies (Diptera: Syrphidae) #> journal first_author uploaded_date length #> 1 Unpublished Penny,H.D. 03-NOV-2012 658 #> sequence #> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000") #> using sleep: 0 #> ══ 1 queries ═══════════════ #> ✔ Found: Umbra+limi #> ══ Results ═════════════════ #> #> ● Total: 1 #> ● Found: 1 #> ● Not Found: 0 head(out) #> taxon length #> 1 Umbra limi 298 #> 2 Umbra limi 761 #> 3 Umbra limi 765 #> 4 Umbra limi 764 #> 5 Umbra limi 743 #> 6 Umbra limi 758 #> gene_desc #> 1 Umbra limi voucher Umbra_limi_GLF16S large subunit ribosomal RNA gene, partial sequence; mitochondrial #> 2 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds #> 3 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds #> 4 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds #> 5 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds #> 6 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds #> acc_no gi_no #> 1 MT549086 1847697133 #> 2 KX146134 1049488959 #> 3 KX146015 1049488721 #> 4 KX145969 1049488629 #> 5 KX145777 1049488245 #> 6 KX145759 1049488209
traitbank(query = "MATCH (n:Trait) RETURN n LIMIT 1;") #> $columns #> [1] "n" #> #> $data #> $data[[1]] #> metadata.id metadata.labels data.eol_pk data.object_page_id #> 1 22529388 Trait R20-PK20910350 46581789 #> data.resource_pk #> 1 ReverseOf_globi:assoc:7296029-FBC:FB:SpecCode:4755-ATE-EOL_V2:281 #> data.scientific_name #> 1 Plantae #> data.source #> 1 Froese, R. and D. Pauly. Editors. 2019. FishBase. World Wide Web electronic publication. www.fishbase.org, version (08/2019). Accessed at <https://github.com/globalbioticinteractions/fishbase/archive/6ebceaacea18c6ff6c247182f9af8ad6fc05cc82.zip> on 25 May 2020.
Habitat data
birdlife_habitat(22721692) #> id Habitat (level 1) Habitat (level 2) Importance #> 1 22721692 Forest Subtropical/Tropical Dry major #> 2 22721692 Forest Subtropical/Tropical Moist Montane major #> 3 22721692 Forest Temperate suitable #> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable #> Occurrence #> 1 breeding #> 2 non-breeding #> 3 breeding #> 4 breeding
Threats data
birdlife_threats(22721692) #> id threat1 #> 1 22721692 Agriculture & aquaculture #> 2 22721692 Agriculture & aquaculture #> 3 22721692 Biological resource use #> 4 22721692 Climate change & severe weather #> 5 22721692 Climate change & severe weather #> 6 22721692 Climate change & severe weather #> 7 22721692 Invasive and other problematic species, genes & diseases #> 8 22721692 Invasive and other problematic species, genes & diseases #> 9 22721692 Invasive and other problematic species, genes & diseases #> 10 22721692 Invasive and other problematic species, genes & diseases #> 11 22721692 Invasive and other problematic species, genes & diseases #> 12 22721692 Invasive and other problematic species, genes & diseases #> 13 22721692 Natural system modifications #> 14 22721692 Natural system modifications #> 15 22721692 Residential & commercial development #> 16 22721692 Transportation & service corridors #> threat2 #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> stresses #> 1 Ecosystem degradation, Ecosystem conversion, Other #> 2 Ecosystem degradation, Ecosystem conversion, Other #> 3 Ecosystem degradation #> 4 Ecosystem degradation #> 5 Ecosystem degradation, Ecosystem conversion #> 6 Ecosystem degradation #> 7 Ecosystem degradation, Ecosystem conversion #> 8 Species mortality #> 9 Ecosystem degradation #> 10 Ecosystem degradation #> 11 Ecosystem degradation, Reduced reproductive success #> 12 Species mortality #> 13 Ecosystem degradation, Ecosystem conversion #> 14 Ecosystem degradation, Ecosystem conversion #> 15 Ecosystem degradation, Ecosystem conversion, Species mortality, Other #> 16 Species mortality #> timing #> 1 Agriculture & aquaculture #> 2 Agriculture & aquaculture #> 3 Biological resource use #> 4 Climate change & severe weather #> 5 Climate change & severe weather #> 6 Climate change & severe weather #> 7 Invasive and other problematic species, genes & diseases #> 8 Invasive and other problematic species, genes & diseases #> 9 Invasive and other problematic species, genes & diseases #> 10 Invasive and other problematic species, genes & diseases #> 11 Invasive and other problematic species, genes & diseases #> 12 Invasive and other problematic species, genes & diseases #> 13 Natural system modifications #> 14 Natural system modifications #> 15 Residential & commercial development #> 16 Transportation & service corridors #> scope #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> severity impact #> 1 Ongoing Ongoing #> 2 Ongoing Ongoing #> 3 Ongoing Ongoing #> 4 Ongoing Ongoing #> 5 Future Future #> 6 Ongoing Ongoing #> 7 Ongoing Ongoing #> 8 Ongoing Ongoing #> 9 Ongoing Ongoing #> 10 Ongoing Ongoing #> 11 Ongoing Ongoing #> 12 Ongoing Ongoing #> 13 Ongoing Ongoing #> 14 Future Future #> 15 Ongoing Ongoing #> 16 Ongoing Ongoing
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.