extrDNAIncDiv: The Increment Of Diversity Descriptors
In BioMedR: Generating Various Molecular Representations for Chemicals, Proteins, DNAs/RNAs and Their Interactions

Description Usage Arguments Details Value Author(s) References See Also Examples

The Increment Of Diversity Descriptors

1	extrDNAIncDiv(k = 6, x, pos, neg, upto = TRUE)

`k`	the k value of kmer, it should be an integer larger than 0,the default value is 6.
`x`	the input data, which should be a list or file type.
`pos`	the positive source data, which should be a or type.
`neg`	the negative source data, which should be or type.
`upto`	generate all the kmers: 1mer, 2mer, ..., kmer. The output feature vector is the combination of all these kmers. The default value of this parameter is True

This function calculates the The Basic Kmer Descriptor

if upto is True, A length k * 2 named vector, k is the k value of kmer; if upto is False, A length 2 named vector

Min-feng Zhu <wind2zhu@163.com>

Chen W, Luo L, Zhang L. The organization of nucleosomes around splice sites. Nucleic acids research, 2010, 38(9): 2788-2798. Liu G, Liu J, Cui X, et al. Sequence-dependent prediction of recombination hotspots in Saccharomyces cerevisiae. Journal of theoretical biology, 2012, 293: 49-54.

See extrDNAkmer

pos = readFASTA(system.file('dnaseq/pos.fasta', package = 'BioMedR'))
neg = readFASTA(system.file('dnaseq/neg.fasta', package = 'BioMedR'))
x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrDNAIncDiv(k = 6, x, pos, neg)