extrDNATCC: The Trinucleotide-based Cross Covariance Descriptor

In BioMedR: Generating Various Molecular Representations for Chemicals, Proteins, DNAs/RNAs and Their Interactions

Description

The Trinucleotide-based Cross Covariance Descriptor

Usage

extrDNATCC(x, index = c("Dnase I", "Nucleosome"), nlag = 2,
  customprops = NULL, normaliztion = FALSE)

Arguments

x	the input data, which should be a list or file type.
index	the physicochemical indices, it should be a list and there are 12 different physicochemical indices (Table 2), which the users can choose.
nlag	an integer larger than or equal to 0 and less than or equal to L-2 (L means the length of the shortest DNA sequence in the dataset). It represents the distance between two dinucleotides.
customprops	the users can use their own indices to generate the feature vector. It should be a dict, the key is dinucleotide (string), and its corresponding value is a list type.
normaliztion	with this option, the final feature vector will be normalized based on the total occurrences of all kmers. Therefore, the elements in the feature vectors represent the frequencies of kmers. The default value of this parameter is False.

Details

This function calculates the trinucleotide-based cross covariance Descriptor

Value

A vector

Note

if the user defined physicochemical indices have not been normalized, it should be normalized.

Author(s)

Min-feng Zhu <[e-mail]>

See Also

See extrDNATAC and extrDNATACC

Examples

x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrDNATCC(x)

BioMedR documentation built on Nov. 17, 2017, 10:08 a.m.