GeneCodon: Optimizing the codon usage of gene by replacing less usage...

In GeneGA: Design gene based on both mRNA secondary structure and codon usage bias using Genetic algorithm

Description

The function adjusts the codon usage of gene by replacing less usage codons(the most preference codons) with the most preference codons(less usage codons).

Usage

GeneCodon(seq, organism = "ec", max=TRUE, scale=0.5, numcode= 1)

Arguments

seq	the sequence to optimize
organism	the organism that gene due to express, GeneGA contains codon usage bias information of almost 200 genomes
max	if max is TRUE, less usage codons will be replaced with the most preference codons, and vice versa.
scale	When max is FALSE, scale is used to assign the range of less used synonymous codons of each amino acid to sample. The default value is 0.5, it means each codon will be sampled from its 50% less used synonymous codons.
numcode	The ncbi genetic code number for translation. By default the standard genetic code is used. Referring to the help page of "translate" function in seqinr package for details

Value

This function returns the optimized sequence as string. If max is True, sequence consisting of most preference used codons will be returned,

Author(s)

Zhenpeng Li, Fei Li, Xiaochen Bo and Shengqi Wang

See Also

wSet, GeneGA

Examples

seqfile=system.file("sequence","EGFP.fasta",package="GeneGA")
seq=unlist(getSequence(read.fasta(seqfile),as.string=TRUE))
GeneCodon(seq)

Example output

Loading required package: seqinr
Loading required package: hash
hash-3.0.1 provided by Decision Patterns

[1] "ATGGTTTCTAAAGGTGAAGAACTGTTCACCGGTGTTGTTCCGATCCTGGTTGAACTGGACGGTGACGTTAACGGTCACAAATTCTCTGTTTCTGGTGAAGGTGAAGGTGACGCTACCTACGGTAAACTGACCCTGAAATTCATCTGCACCACCGGTAAACTGCCGGTTCCGTGGCCGACCCTGGTTACCACCCTGACCTACGGTGTTCAGTGCTTCTCTCGTTACCCGGACCACATGAAACAGCACGACTTCTTCAAATCTGCTATGCCGGAAGGTTACGTTCAGGAACGTACCATCTTCTTCAAAGACGACGGTAACTACAAAACCCGTGCTGAAGTTAAATTCGAAGGTGACACCCTGGTTAACCGTATCGAACTGAAAGGTATCGACTTCAAAGAAGACGGTAACATCCTGGGTCACAAACTGGAATACAACTACAACTCTCACAACGTTTACATCATGGCTGACAAACAGAAAAACGGTATCAAAGTTAACTTCAAAATCCGTCACAACATCGAAGACGGTTCTGTTCAGCTGGCTGACCACTACCAGCAGAACACCCCGATCGGTGACGGTCCGGTTCTGCTGCCGGACAACCACTACCTGTCTACCCAGTCTGCTCTGTCTAAAGACCCGAACGAAAAACGTGACCACATGGTTCTGCTGGAATTCGTTACCGCTGCTGGTATCACCCTGGGTATGGACGAACTGTACAAATAA"

GeneGA documentation built on Nov. 8, 2020, 8:17 p.m.