| get_seed | R Documentation |
Given a sequence greater than 8 bp oriented 5' -> 3' and a seed
definition, this function will return an object containing seed-specific sequence
information. Users can input a custom seed name, but must provide the start
position (start.pos) and stop position (stop.pos) that define the
range of the seed sequence.
Built-in options: mer8, mer7A1, mer7m8, mer6
Note: The seed definitions mer8 and mer7A1 force a U at position g1.
This results in an A in the target sequence being searched.
get_seed(guide.seq, seed.name = "mer7m8", start.pos = 1, stop.pos = 8)
guide.seq |
A character string greater than 8 bp and oriented 5'-> 3'. |
seed.name |
The seed name of interest. Options: mer8, mer7A1, mer7m8, mer6. If not in the default list, the start.pos and stop.pos arguments will be used to define the seed. |
start.pos |
The start position for a custom seed definition |
stop.pos |
The stop position for a custom seed definition |
An object with the entries:
Guide: Input guide sequence. Input is expected to be RNA.
Seed.Name: The seed name.
Seed.Seq.RNA: The seed sequence as a RNAString
Seed.Seq.DNA: The seed sequence as a DNAString
Target.Seq: The target DNA sequence based on the reverse complement of
the seed as a DNAString
# Example Ttr from Schlegel et al. 2022
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"
# Get seed match
seed.seq = get_seed(guide.seq, "mer7m8")
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.