library(SELEX) library(stringi) library(Biostrings) library(SelexGLM) library(devtools) library(reshape2) library(ggplot2) library(Rmisc)
We start with some initialization related to the SELEX package:
options(java.parameters = "-Xmx4000M") workDir = tempdir() selex.config(workingDir=workDir, maxThreadNumber=4)
Next, we will define the SELEX samples that we want to analyze. We will use the example data from the SELEX package:
selex.loadAnnotation(system.file("extdata", "config.xml", package="SELEX")) selex.sampleSummary()
r0.train = selex.sample(seqName = 'R0.libraries', sampleName='R0.barcodeGC', round = 0) r0.test = selex.sample(seqName = 'R0.libraries', sampleName='R0.barcodeCG', round = 0) dataSample = selex.sample(seqName = 'R2.libraries', sampleName = 'ExdHox.R2', round = 2)
Markov model is built, information gain is used to identify k-mer length of binding site, kmer tables are built, and probes are counted in a way that corrects for the zero-deflated nature of data corrected.
# MARKOV MODEL BUILT kmax = selex.kmax(sample = r0.test) # Train Markov model on Hm 16bp library Round 0 data mm = selex.mm(sample = r0.train, order = NA, crossValidationSample =r0.test, Kmax = kmax, mmMethod = "TRANSITION") mmscores = selex.mmSummary(sample = r0.train) ido = which(mmscores$R==max(mmscores$R)) mm.order = mmscores$Order[ido]
More preliminaries:
# INFOGAIN USED TO CALCULATE KLEN libLen = as.numeric(as.character(selex.getAttributes(dataSample)$VariableRegionLength)) selex.infogain(sample = dataSample, k = c((mm.order+1):libLen), markovModel = mm) infoscores = selex.infogainSummary(sample = dataSample) #information gain barplot idx = which(infoscores$InformationGain==max(infoscores$InformationGain)) colstring = rep('BLUE', nrow(infoscores)) colstring[idx] = 'RED' barplot(height=infoscores$InformationGain, names.arg=infoscores$K, col=colstring, xlab="Oligonucleotide Length (bp)", ylab="Information Gain (bits)") kLen = infoscores$K[idx]
# For the sake of previous analysis on the Hox data used in this example, I will use kLen.f = 12 as my k-mer length, even though kLen identified through the information gain analysis has kLen = 13 data.kmerTable = selex.affinities(sample=dataSample, k=kLen, markovModel=mm) data.kmerTable = data.kmerTable[order(-data.kmerTable$Affinity), ] rownames(data.kmerTable) = NULL data.probeCounts = getProbeCounts(dataSample, markovModel = mm) summary(data.probeCounts) print(data.probeCounts[1:10,])
# Inputs about library are data specific model = new("model", varRegLen = libLen, leftFixedSeq = "GTTCAGAGTTCTACAGTCCGACGATCTGG", rightFixedSeq ="CCAGCTGTCGTATGCCGTCTTCTGCTTG", seedLen = kLen, leftFixedSeqOverlap = 4, initialAffinityCutoff = 0.00, missingValueSuppression = 1, minSeedValue = .001, upFootprintExtend = 2, includeWindowFactor = FALSE, confidenceLevel = .95, verbose = FALSE, useFixedValuesOffset.N = FALSE, rounds = list(c(2)), rcSymmetric = FALSE, minAffinity = 0.01 )
Inspect current state of model object:
model@features@N
# Model nucleotide Betas before seed PSAM is added addSeedPsam(model) = seedTable2psam(model, data.kmerTable) # Model nucleotide Betas after seed PSAM is added model@features@N
#Use this definition of data for complete analysis data = data.probeCounts data = topModelMatch(data, model) # Uses aligned probes to build design matrix data = addDesignMatrix(data, model) # Constructs regression expression with independent features using design matrix regressionFormula = updatedRegressionFormula(data, model) fit = glm(regressionFormula, data=data, family = poisson(link="log")) model = addNewBetas(model, data, fit) # Nucleotide Features after first round of fitting # GABRIELLA: this plotting commmand is not working, can you fix it? #plot(model, Nplot.ddG = TRUE, verticalPlots = TRUE) data = data.probeCounts data.nrow = nrow(data) for (i in 2:3) { data = topModelMatch(data, model) data = addDesignMatrix(data, model) if (data.nrow == nrow(data)) { print ("Stability Reached") break } else { data.nrow = nrow(data) } regressionFormula = updatedRegressionFormula(data, model) fit = glm(regressionFormula, data=data, family = poisson(link="log")) model = addNewBetas(model,data,fit) # Nucleotide Features after i'th round of fitting } model@features@N@N.values
Save model object for future reference:
save(model, file = "HowToFitMononucleotideModel.Result.RData")
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.