Sijie Xu 08 Dec 2020
rseAnalysis (RNA structure and Expression analysis) package includes
series of utility function including stander file reader, structural
prediction, RNA distance calculation, and analysis package.
rseAnalysis provides an all-in-one solution for gene expression and
secondary structure mutation correlation analysis by automating the data
processing and analysis of gene expression and mutation data from the
well-acknowledged database such as mirBase and TCGA.
To download MPLNClust, use the following commands:
# install.packages("devtools")
devtools::install_github("JackXu2333/rseAnalysis")
The function vcf2df, fasta2df, and bed2df provides measures to read file with vcf, fasta, and bed extensions. The output file structures is as followed:
fasta object
bed object
vcf object
#Source library
library(rseAnalysis)
#Load sample data file
vcf <- rseAnalysis::vcf2df(system.file("extdata", "hsa_GRCh37.vcf", package = "rseAnalysis"))
#> Scanning file to determine attributes.
#> File attributes:
#> meta lines: 13
#> header_line: 14
#> variant count: 15058
#> column count: 8
#> Meta line 13 read in.
#> All meta lines processed.
#> gt matrix initialized.
#> Character matrix gt created.
#> Character matrix gt rows: 15058
#> Character matrix gt cols: 8
#> skip: 0
#> nrows: 15058
#> row_num: 0
#> Processed variant 1000Processed variant 2000Processed variant 3000Processed variant 4000Processed variant 5000Processed variant 6000Processed variant 7000Processed variant 8000Processed variant 9000Processed variant 10000Processed variant 11000Processed variant 12000Processed variant 13000Processed variant 14000Processed variant 15000Processed variant: 15058
#> All variants processed
fasta <- rseAnalysis::fasta2df(system.file("extdata", "hsa_GRCh37.fasta", package = "rseAnalysis"))
bed <- rseAnalysis::bed2df(system.file("extdata", "hsa_GRCh37.bed", package = "rseAnalysis"))
#Inspect the imported file
head(vcf)
#> CHROM POS ID REF ALT
#> 1 1 17375 MU29195949 A G
#> 2 1 17375 MU29195949 A G
#> 3 1 17385 MU28690335 G A
#> 4 1 17385 MU28690335 G A
#> 5 1 17407 MU63855538 G A
#> 6 1 17408 MU27355001 C G
#> CONSEQUENCE
#> 1 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||splice_region_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||splice_region_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> 2 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||splice_region_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||splice_region_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> 3 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> 4 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> 5 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> 6 WASH7P|ENSG00000227232|1|WASH7P-201|ENST00000423562||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-202|ENST00000438504||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-001|ENST00000450305||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-002|ENST00000456328||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-001|ENST00000488147||intron_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-201|ENST00000515242||downstream_gene_variant||,DDX11L1|ENSG00000223972|+|DDX11L1-202|ENST00000518655||downstream_gene_variant||,WASH7P|ENSG00000227232|1|WASH7P-203|ENST00000538476||intron_variant||,WASH7P|ENSG00000227232|1|WASH7P-204|ENST00000541675||intron_variant||
#> OCCURRENCE
#> 1 LAML-KR|1|205|0.00488,BRCA-EU|1|569|0.00176,PRAD-UK|2|140|0.01429
#> 2 LAML-KR|1|205|0.00488,BRCA-EU|1|569|0.00176,PRAD-UK|2|140|0.01429
#> 3 COCA-CN|1|321|0.00312,LAML-KR|1|205|0.00488
#> 4 COCA-CN|1|321|0.00312,LAML-KR|1|205|0.00488
#> 5 COCA-CN|1|321|0.00312
#> 6 PBCA-US|2|186|0.01075
#> affected_donors project_count
#> 1 4 3
#> 2 4 3
#> 3 2 2
#> 4 2 2
#> 5 1 1
#> 6 2 1
head(fasta)
#> NAME
#> 1 hsa-let-7a-1
#> 2 hsa-let-7a-2
#> 3 hsa-let-7a-3
#> 4 hsa-let-7b
#> 5 hsa-let-7c
#> 6 hsa-let-7d
#> SEQ
#> 1 UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
#> 2 AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
#> 3 GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU
#> 4 CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG
#> 5 GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC
#> 6 CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG
head(bed)
#> CHROM STAPOS ENDPOS DIR TYPE ID ALIAS
#> 1 1 17368 17391 - miRNA MIMAT0027619 MIMAT0027619
#> 2 1 17368 17436 - miRNA_primary_transcript MI0022705 MI0022705
#> 3 1 17408 17431 - miRNA MIMAT0027618 MIMAT0027618
#> 4 1 30365 30503 + miRNA_primary_transcript MI0006363 MI0006363
#> 5 1 30437 30458 + miRNA MIMAT0005890 MIMAT0005890
#> 6 1 567994 568065 - miRNA_primary_transcript MI0039740 MI0039740
#> NAME
#> 1 hsa-miR-6859-3p
#> 2 hsa-mir-6859-1
#> 3 hsa-miR-6859-5p
#> 4 hsa-mir-1302-2
#> 5 hsa-miR-1302
#> 6 hsa-mir-12136
Find mutated RNA sequence based on the fasta, bed and vcf files
#Mutate RNA using mutation from vcf files
RNA.mutated <- RNA.validate(fasta = fasta,
vcf = vcf,
bed = bed)
#> The matching rate of the dataset is 0.714159236071587
Noted that message stated that the mutation has matching rate 0.714, this represents that only 71.4% of the mutation reference matches the gene sequence on sequence provided (fasta), and the remaining 28.6% of the sequence failed to match due to misalignment, differences in genome assemble in bed and fasta file, or potentially different representation of wildtype among vcf file and fasta file. For tutorial purposes, we will skip the mismatches and predict the secondary structure for the remaining.
# ================== Sample code for RNA secondary structure prediction ==========================
#
# struct.ori <- suppressMessages(predictStructure(executable.path = "../inst/extdata/exe"
# , rna.name = RNA.mutated$NAME, rna.seq = RNA.mutated$SEQ))
# struct.alt <- suppressMessages(predictStructure(executable.path = "../inst/extdata/exe"
# , rna.name = RNA.mutated$NAME, rna.seq = RNA.mutated$MUT.SEQ))
# Read prerun result from the predictStructure
RNA.mutated <- subset(RNA.mutated, MATCH)[1:200,]
struct.ori <- read.csv(system.file("extdata", "vignetteSampleORI.csv", package = "rseAnalysis"))
struct.alt <- read.csv(system.file("extdata", "vignetteSampleALT.csv", package = "rseAnalysis"))
head(struct.ori)
#> X
#> 1 hsa-let-7a-1
#> 2 hsa-let-7a-1
#> 3 hsa-let-7a-1
#> 4 hsa-let-7a-1
#> 5 hsa-let-7a-1
#> 6 hsa-let-7a-1
#> struct.ori
#> 1 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 2 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 3 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 4 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 5 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 6 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
head(struct.alt)
#> X
#> 1 hsa-let-7a-1
#> 2 hsa-let-7a-1
#> 3 hsa-let-7a-1
#> 4 hsa-let-7a-1
#> 5 hsa-let-7a-1
#> 6 hsa-let-7a-1
#> struct.alt
#> 1 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 2 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 3 (((((.((((..(((((((((((((((.....(((...((((....)))).))))))))))))))))))..)))))))))
#> 4 (((((.((((..(((((((((((((((.....(((...((((....)))).))))))))))))))))))..)))))))))
#> 5 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
#> 6 (((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))
Calculation RNADistance based on the result from structural prediction
is straightforward, the result help determines how much of a structural
difference there are among the original and mutated RNA sequence.
Executable.path is omitted for mac or Unix user who has RNAStructure
installed see more at ?predict.distance
#Run prediction
RNA.distance <- predictDistance(name = RNA.mutated$NAME
, struct.ori = struct.ori$struct.ori
, struct.alt = struct.alt$struct.alt
, method = "gsc")
#> Loading files..
#Load expression data
expression <- read.csv(system.file("extdata", "test.csv", package = "rseAnalysis"), header = TRUE)
#Use only standardize read
expression <- subset(expression, Read.Type == "reads_per_million_miRNA_mapped")[1:200, ]
result <- Analysis.DISEXP(dis.name = RNA.mutated$NAME, dis.distance = RNA.distance,
exp.tumor = expression$Sample, exp.sample = expression$Normal, method = "linear", showPlot = FALSE)
#Display statistical result
result$stats
#> $Correlation
#> [1] -0.1062221
#>
#> $PValue
#> [1] 0.1343854
#Display plots
result$plots
#> $ScatterPlot

#>
#> $GeneExpressionBoxPlot

#>
#> $RNADistanceBoxPlot

#>
#> $RNADistanceDensityPlot
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf

#>
#> $GeneExpressionDensityPlot
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning: Groups with fewer than two data points have been dropped.
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf
#> Warning in max(ids, na.rm = TRUE): no non-missing arguments to max; returning -
#> Inf

Analysis.DISEXP uses the absolute difference in expression in modelling change in expression between the tumour and normal samples from BRCA patients. Here we use “reads_per_million_miRNA_mapped” as the input because it is standardized and can use to compare between cases. !Beware that for the analysis to work, one has to make sure the gene expression data and distance data are collected from the same type of mutation, or from the same sample (usually a sample will be insufficient in retrieving both expression and sequencing information), or it affects the outcome of the analysis dramatically.
Gere the Analysis.DISEXP generate both text and graphical output, with text output indicating the beta and p_value of the resulting regression model. From this example, the correlation between RNA distance is -0.11 with p-value of 0.12. The graphical output shows the prediction model and confidence interval on the scatter plot, RNA distance distribution by RNA type and boxplots showing the potential outliers from gene expression and RNA distance data set.
Kozomara, A., & Griffiths-Jones, S. (2011). miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic acids research, 39(Database issue), D152–D157. https://doi.org/10.1093/nar/gkq1027
Wickham, H. and Bryan, J. (2019). R Packages (2nd edition). Newton, Massachusetts: O’Reilly Media. https://r-pkgs.org/
TCGA Research Network: https://www.cancer.gov/tcga.
Zhiwen. T, Sijie Xu (2020) miRNA Motif Analysis https://github.com/Deemolotus/BCB330Y-and-BCB430Y/tree/master/Main
#[END]
sessionInfo()
#> R version 4.0.2 (2020-06-22)
#> Platform: x86_64-apple-darwin17.0 (64-bit)
#> Running under: macOS Catalina 10.15.7
#>
#> Matrix products: default
#> BLAS: /Library/Frameworks/R.framework/Versions/4.0/Resources/lib/libRblas.dylib
#> LAPACK: /Library/Frameworks/R.framework/Versions/4.0/Resources/lib/libRlapack.dylib
#>
#> locale:
#> [1] C/en_CA.UTF-8/en_CA.UTF-8/C/en_CA.UTF-8/en_CA.UTF-8
#>
#> attached base packages:
#> [1] stats graphics grDevices utils datasets methods base
#>
#> other attached packages:
#> [1] rseAnalysis_0.1.0
#>
#> loaded via a namespace (and not attached):
#> [1] colorspace_1.4-1 seqinr_4.2-4
#> [3] ellipsis_0.3.1 rprojroot_1.3-2
#> [5] XVector_0.28.0 GenomicRanges_1.40.0
#> [7] fs_1.5.0 rstudioapi_0.11
#> [9] farver_2.0.3 roxygen2_7.1.1
#> [11] remotes_2.2.0 bit64_4.0.5
#> [13] AnnotationDbi_1.50.3 fansi_0.4.1
#> [15] xml2_1.3.2 splines_4.0.2
#> [17] R.methodsS3_1.8.1 memuse_4.1-0
#> [19] geneplotter_1.66.0 knitr_1.30
#> [21] pkgload_1.1.0 ade4_1.7-15
#> [23] annotate_1.66.0 cluster_2.1.0
#> [25] R.oo_1.24.0 compiler_4.0.2
#> [27] backports_1.1.10 assertthat_0.2.1
#> [29] Matrix_1.2-18 cli_2.1.0
#> [31] htmltools_0.5.0 prettyunits_1.1.1
#> [33] tools_4.0.2 gtable_0.3.0
#> [35] glue_1.4.2 GenomeInfoDbData_1.2.3
#> [37] dplyr_1.0.2 Rcpp_1.0.5
#> [39] Biobase_2.48.0 vctrs_0.3.4
#> [41] Biostrings_2.56.0 ape_5.4-1
#> [43] nlme_3.1-149 pinfsc50_1.2.0
#> [45] xfun_0.18 stringr_1.4.0
#> [47] ps_1.4.0 testthat_2.3.2
#> [49] lifecycle_0.2.0 devtools_2.3.2
#> [51] XML_3.99-0.5 NameNeedle_1.2.6
#> [53] zlibbioc_1.34.0 MASS_7.3-53
#> [55] scales_1.1.1 parallel_4.0.2
#> [57] SummarizedExperiment_1.18.2 gscVisualizer_0.1.0
#> [59] RColorBrewer_1.1-2 yaml_2.2.1
#> [61] memoise_1.1.0 gridExtra_2.3
#> [63] ggplot2_3.3.2 reshape_0.8.8
#> [65] stringi_1.5.3 RSQLite_2.2.1
#> [67] genefilter_1.70.0 S4Vectors_0.26.1
#> [69] desc_1.2.0 permute_0.9-5
#> [71] BiocGenerics_0.34.0 pkgbuild_1.1.0
#> [73] BiocParallel_1.22.0 GenomeInfoDb_1.24.2
#> [75] rlang_0.4.8 pkgconfig_2.0.3
#> [77] matrixStats_0.57.0 bitops_1.0-6
#> [79] evaluate_0.14 lattice_0.20-41
#> [81] purrr_0.3.4 labeling_0.3
#> [83] bit_4.0.4 processx_3.4.4
#> [85] tidyselect_1.1.0 plyr_1.8.6
#> [87] magrittr_1.5 DESeq2_1.28.1
#> [89] R6_2.4.1 IRanges_2.22.2
#> [91] generics_0.0.2 DelayedArray_0.14.1
#> [93] DBI_1.1.0 pillar_1.4.6
#> [95] withr_2.3.0 mgcv_1.8-33
#> [97] survival_3.2-7 RCurl_1.98-1.2
#> [99] tibble_3.0.4 crayon_1.3.4
#> [101] R.rsp_0.44.0 rmarkdown_2.4
#> [103] vcfR_1.12.0 usethis_1.6.3
#> [105] locfit_1.5-9.4 grid_4.0.2
#> [107] blob_1.2.1 callr_3.5.1
#> [109] vegan_2.5-6 digest_0.6.25
#> [111] xtable_1.8-4 R.cache_0.14.0
#> [113] tidyr_1.1.2 R.utils_2.10.1
#> [115] stats4_4.0.2 munsell_0.5.0
#> [117] viridisLite_0.3.0 sessioninfo_1.1.1
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.