writeDotBracket: Writes a file with the sequence and secondary structure of an...
In LaraSellesVidal/ncRNAtools: An R toolkit for non-coding RNA

Description Usage Arguments Value References Examples

View source: R/ncRNAtools_readWriteFunctions.R

Writes a file with the sequence and secondary structure of an RNA in the Dot-Bracket format.

1	writeDotBracket(filename, sequence, secondaryStructure, sequenceName="Sequence")

`filename`	A string indicating the path to the Dot-Bracket file to be written. A description of the Dot-Bracket format can be found at https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html. The resulting file will contain three lines. The first line starts with ">", after which the name of the sequence follows. The second line contains the RNA sequence. The third line contains the secondary structure representation in Dot-Bracket notation.
`sequence`	A string with the full-length sequence of the RNA for which a Dot-Bracket file should be written.
`secondaryStructure`	A string representing the secondary structure of the RNA sequence in the Dot-Bracket format.
`sequenceName`	A string with the name of the RNA sequence for which a Dot-Bracket file should be written.

Called for its effect of writing a Dot-Bracket file. Invisibly returns the status code returned by close when closing the file connection. See documentation of close for details.

https://software.broadinstitute.org/software/igv/RNAsecStructure

http://projects.binf.ku.dk/pgardner/bralibase/RNAformats.html

# Write a Dot-Bracket file by providing an RNA sequence and its secondary structure in
# the Dot-Bracket format:

tempDir <- tempdir()
DotBracketFile <- paste(tempDir, "testDotBracketFile.dot", sep="")
writeDotBracket(DotBracketFile, "AGCGGGUUCCUGGUUCCCCAAGGUUGA",
secondaryStructure="...(((..((.))..))).((..))..", sequenceName="Test sequence")