context("Nearest neighbour methods for internal loop effect are OK")
test_that("tests for method.internal.loop - DNA/DNA", {
expect_equal(melting(sequence = "GCGATTGGCACTTTGGTGAAC",
comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001,
hybridisation.type = "dnadna",
Na.conc = 1)$Results$`Melting temperature (C)`,
84.09052, tolerance = 1e-5, label = "DNA/DNA default")
expect_equal(melting(sequence = "GCGATTGGCACTTTGGTGAAC",
comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001,
hybridisation.type = "dnadna",
Na.conc = 1,
method.internal.loop = "san04")$Results$`Melting temperature (C)`,
84.09052, tolerance = 1e-5, label = "tan04")
})
test_that("tests for method.internal.loop - RNA/RNA", {
expect_equal(melting(sequence = "GACAC-GCUG",
comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna",
Na.conc = 1)$Results$`Melting temperature (C)`,
45.98713, tolerance = 1e-5, label = "RNA/RNA default")
expect_equal(melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna",
Na.conc = 1,
method.internal.loop = "zno07")$Results$`Melting temperature (C)`,
40.49012, tolerance = 1e-5, label = "tur06")
expect_equal(melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna",
Na.conc = 1,
method.internal.loop = "tur06")$Results$`Melting temperature (C)`,
45.98713, tolerance = 1e-5, label = "ser07")
})
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.