mitogenome_seq_repos: Reposition a mitogenomic sequence

In j-a-thia/genomalicious: A smorgasbord of R functions for population genomic analyses

Reposition a mitogenomic sequence

Description

This function takes a linear sequence of a mitochondrial genome and repositions it to start at a new base position.

Usage

mitogenome_seq_repos(dnaSeq, newStartPos)

Arguments

dnaSeq	Character: The mitogenomic sequence.
newStartPos	Integer: The new start position for the sequence.

Details

The sequence is repositioned with respect to the value of newStartPos. For example, consider a value of dnaSeq:

GCGCGCGCGCATATGACTAA

For a value of newStartPos==10, the 10th base would become the new start position and the 9th position in the original sequence is a cutoff. Below this cutoff, the sequence is translocated to the right.

GCGCGCGCG | CATATGACTAA (original sequence, cut at 9th base)

CATATGACTAAGCGCGCGCG (new sequence, repositioned)

j-a-thia/genomalicious documentation built on Oct. 19, 2024, 7:51 p.m.