README.md

PrimerTree

Travis-CI Build Status PrimerTree: Visually Assessing the Specificity and Informativeness of Primer Pairs

Features

Installation

R installation

CRAN

install.packages('primerTree')

Github

# install.packages("devtools")
devtools::install_github("jimhester/primerTree")

Clustal Omega Installation

Windows

Use the pre-compiled windows binary. Either put the installed clustalo.exe in your path, or pass the path to the executable in the clustal_options option

library(primerTree)
mammals_16S = search_primer_pair(name='Mammals 16S',
  'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT', clustal_options=c(exec='C:\Program Files\Clustal Omega\clustalo.exe'))

Linux

Simple installation from source

./configure && make && make install

If the resulting clustalo program is in your path it should be automatically found, otherwise see the windows instructions on how to specify the path to the executable.

Usage

Simple search for a Mammal 16S primer

library(primerTree)
mammals_16S = search_primer_pair(name='Mammals 16S', 'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT')
plot(mammals_16S)

Using the parallel features with the multicore package using the doMC backend, with 8 threads.

library(doMC)
registerDoMC(8)
library(primerTree)
mammals_16S = search_primer_pair(name='Mammals 16S',
  'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT', .parallel=T)
plot(mammals_16S)


jimhester/primerTree documentation built on May 19, 2019, 10:33 a.m.