search_primer_pair: Automatic primer searching Search a given primer pair,...

Description Usage Arguments Value See Also Examples

Description

Automatic primer searching Search a given primer pair, retrieving the alignment results, their product sequences, the taxonomic information for the sequences, a multiple alignment of the products

Usage

1
2
3
4
search_primer_pair(forward, reverse, name = NULL, num_aligns = 500,
  num_permutations = 25, simplify = TRUE, clustal_options = list(),
  distance_options = list(model = "N", pairwise.deletion = T), ...,
  .parallel = FALSE, .progress = "none")

Arguments

forward

forward primer to search by 5'-3' on plus strand

reverse

reverse primer to search by 5'-3' on minus strand

name

name to give to the primer pair

num_aligns

number of alignment results to keep

num_permutations

the number of primer permutations to search, if the degenerate bases cause more than this number of permutations to exist, this number will be sampled from all possible permutations.

simplify

use simple names for primer hit results or complex

clustal_options

a list of options to pass to clustal omega, see link{clustalo} for a list of options

distance_options

a list of options to pass to dist.dna, see link{dist.dna} for a list of options

...

additional arguments passed to Primer-Blast

.parallel

if 'TRUE', perform in parallel, using parallel backend provided by foreach

.progress

name of the progress bar to use, see create_progress_bar

Value

A list with the following elements,

name

name of the primer pair

BLAST_result

html blast results from Primer-BLAST as 'a response

object.

taxonomy

taxonomy for the primer products from NCBI

sequence

sequence of the primer products

alignment

multiple alignment of the primer products

tree

phylogenetic tree of the reconstructed from the 'multiple alignment

See Also

primer_search, clustalo

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
## Not run: 
#simple search
mammals_16S = search_primer_pair(name='Mammals 16S',
 'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT')
#returning 1000 alignments, allow up to 3 mismatches in primer
mammals_16S = search_primer_pair(name='Mammals 16S',
 'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT',
 num_aligns=1000, total_primer_specificity_mismatch=3)

## End(Not run)

jimhester/primerTree documentation built on May 19, 2019, 10:33 a.m.