tibble: Simple Data Frames

amt

Version: 0.0.7
Source code: https://github.com/cran/amt
URL: https://github.com/jmsigner/amt
Date/Publication: 2019-09-19 10:20:02 UTC
Number of recursive dependencies: 173

Run revdep_details(,"amt") for more info

checking examples ... ERROR ``` ... > data(amt_fisher) > # Add the month > amt_fisher %>% mutate(yday = lubridate::yday(t_)) %>%
- summarize_sampling_rate_many(c("id", "yday")) Error: No common type for ..1$ts$min and ..2$ts$min . [1m[22m No common type for ..1$ts$min and ..2$ts$min . [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─%>%(...) [90m 2. [39m│ ├─base::withVisible(eval(quote(_fseq(_lhs)), env, env)) [90m 3. [39m│ └─base::eval(quote(_fseq(_lhs)), env, env) [90m 4. [39m│ └─base::eval(quote(_fseq(_lhs)), env, env) [90m 5. [39m│ └─_fseq(_lhs) [90m 6. [39m│ └─magrittr::freduce(value, _function_list) [90m 7. [39m│ ├─base::withVisible(function_list[k]) [90m 8. [39m│ └─function_list[k] [90m 9. [39m│ ├─amt::summarize_sampling_rate_many(., c("id", "yday")) [90m 10. [39m│ └─amt:::summarize_sampling_rate_many.track_xyt(., c("id", "yday")) [90m00_pkg_src/amt/R/eda_sampling_rate.R:94:2[39m [90m 11. [39m│ Execution halted ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘Rcpp’ ‘magrittr’ All declared Imports should be used.

basket

Version: 0.9.10
Source code: https://github.com/cran/basket
URL: https://github.com/kaneplusplus/basket
BugReports: https://github.com/kaneplusplus/basket/issues
Date/Publication: 2019-10-23 07:40:02 UTC
Number of recursive dependencies: 76

Run revdep_details(,"basket") for more info

checking tests ... ``` ... Tibble columns must have consistent sizes, only values of size one are recycled:
- Size 600000: Existing data
- Size 6: Column p0 [1mBacktrace:[22m [90m 1. [39mtestthat::expect_true(inherits(plot_density(mh1), "ggplot")) [90m 6. [39mbasket:::plot_density.exchangeability_model(mh1) [90mrevdep/checks/basket/new/basket.Rcheck/00_pkg_src/basket/R/plot.r:31:2[39m [90m 7. [39mbase::lapply(ps, function(pt) plot_density(x[[pt]])) [90mrevdep/checks/basket/new/basket.Rcheck/00_pkg_src/basket/R/plot.r:50:2[39m [90m 8. [39mbasket:::FUN(X[[i]], ...) [90m 10. [39mbasket:::plot_density.mem(x[[pt]]) [90mrevdep/checks/basket/new/basket.Rcheck/00_pkg_src/basket/R/plot.r:31:2[39m [90m 12. [39mtibble:::$<-.tbl_df(...) [90mrevdep/checks/basket/new/basket.Rcheck/00_pkg_src/basket/R/plot.r:68:2[39m [90m 13. [39mtibble:::tbl_subassign(x, i = NULL, as_string(name), list(value)) [90m 14. [39mtibble:::tbl_subassign_col(x, j, value) [90m 15. [39mtibble:::vec_recycle_rows(...)
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 32 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 2 ] 1. Error: (unknown) (@test-mcmc.r#35) 2. Error: (unknown) (@test-plot.r#12)

Error: testthat unit tests failed Execution halted ```

beadplexr

Version: 0.2.0
Source code: https://github.com/cran/beadplexr
URL: https://gitlab.com/ustervbo/beadplexr
BugReports: https://gitlab.com/ustervbo/beadplexr/issues
Date/Publication: 2018-12-07 23:40:08 UTC
Number of recursive dependencies: 131

Run revdep_details(,"beadplexr") for more info

checking tests ... ``` ... > library(testthat) > library(beadplexr) > > test_check("beadplexr") [31m──[39m [31m1. Error: ident_bead_pop() works (@test_identify_assay_analyte.R#39) [39m [31m──────────[39m Tibble columns must have consistent sizes, only values of size one are recycled:
- Size 5126: Existing data
- Size 2: Column BeadID [1mBacktrace:[22m [90m 1. [39mbase::$<-(*tmp*, BeadID, value = c("A", "B")) [90m 2. [39mtibble:::$<-.tbl_df(*tmp*, BeadID, value = c("A", "B")) [90m 3. [39mtibble:::tbl_subassign(x, i = NULL, as_string(name), list(value)) [90m 4. [39mtibble:::tbl_subassign_col(x, j, value) [90m 5. [39mtibble:::vec_recycle_rows(...)
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 344 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 1 ] 1. Error: ident_bead_pop() works (@test_identify_assay_analyte.R#39)

Error: testthat unit tests failed Execution halted ```

checking Rd cross-references ... NOTE Package unavailable to check Rd xrefs: ‘trimcluster’

bench

Version: 1.0.4
Source code: https://github.com/cran/bench
URL: https://github.com/r-lib/bench
BugReports: https://github.com/r-lib/bench/issues
Date/Publication: 2019-09-06 08:20:02 UTC
Number of recursive dependencies: 74

Run revdep_details(,"bench") for more info

checking examples ... ERROR ``` Running examples in ‘bench-Ex.R’ failed The error most likely occurred in:

Name: autoplot.bench_mark

Title: Autoplot method for bench_mark objects

Aliases: autoplot.bench_mark plot.bench_mark

** Examples

dat <- data.frame(x = runif(10000, 1, 1000), y=runif(10000, 1, 1000))

res <- bench::mark( + dat[dat$x > 500, ], + dat[which(dat$x > 500), ], + subset(dat, x > 500)) Error: All columns in a tibble must be vectors: ```
checking tests ... ``` ... [90m 1. [39mbench::press(...) [90m 5. [39mbench::mark(x) [90m 10. [39mtibble:::as_tibble.list(results, validate = FALSE) [90m 11. [39mtibble:::lst_to_tibble(x, .rows, .name_repair, col_lengths(x)) [90m 12. [39mtibble:::check_valid_cols(x)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 146 | SKIPPED: 2 | WARNINGS: 0 | FAILED: 11 ] 1. Error: mark: Uses all.equal to check results by default (@test-mark.R#36) 2. Error: mark: Can use other functions to check results like identical to check results (@test-mark.R#52) 3. Error: mark: works with capabilities('profmem') (@test-mark.R#69) 4. Error: mark: works without capabilities('profmem') (@test-mark.R#81) 5. Error: mark: Can handle NULL results (@test-mark.R#90) 6. Error: unnest.bench_mark: does not contain result or memory columns (@test-mark.R#184) 7. Error: press: Adds parameters to output (@test-press.R#6) 8. Error: press: Outputs status message before evaluating each parameter (@test-press.R#22) 9. Error: press: expands the grid if has named parameters (@test-press.R#45) 1. ...

Error: testthat unit tests failed Execution halted ```

breathtestcore

Version: 0.4.6
Source code: https://github.com/cran/breathtestcore
URL: https://github.com/dmenne/breathtestcore
BugReports: https://github.com/dmenne/breathtestcore/issues
Date/Publication: 2018-12-18 09:10:03 UTC
Number of recursive dependencies: 92

Run revdep_details(,"breathtestcore") for more info

checking tests ... `` ... > library(testthat) > > #test_check("breathtestcore", filter = "plot_breathtestfit") > test_check("breathtestcore") Loading required package: breathtestcore [31m──[39m [31m1. Error: Single record give valid result after passing through cleanup_data (@t[39mimust have one dimension, not 2. [1mBacktrace:[22m [90m 1. [39mtestthat::expect_lt(rel_diff(d, cf, "m"), 0.02) [90m 4. [39mbreathtestcore:::rel_diff(d, cf, "m") [90m 6. [39mtibble:::[.tbl_df`(cf, cf["parameter"] == parameter, "value") [90m 7. [39mtibble:::tbl_subset_row(xo, i = i) [90m 8. [39mtibble:::vec_as_row_index(i, x) [90m 9. [39mvctrs::vec_as_index(i, nr)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 356 | SKIPPED: 5 | WARNINGS: 0 | FAILED: 1 ] 1. Error: Single record give valid result after passing through cleanup_data (@test_nls_fit.R#46)

Error: testthat unit tests failed Execution halted ```

checking Rd cross-references ... NOTE Package unavailable to check Rd xrefs: ‘breathteststan’

comperank

Version: 0.1.0
Source code: https://github.com/cran/comperank
URL: https://github.com/echasnovski/comperank
BugReports: https://github.com/echasnovski/comperank/issues
Date/Publication: 2018-05-30 08:27:55 UTC
Number of recursive dependencies: 60

Run revdep_details(,"comperank") for more info

checking tests ... ``` ... Component "ranking_def": names for target but not for current Component "ranking_od": names for target but not for current

[31m──[39m [31m8. Failure: rank_od handles numeric player (@test-offense-defense.R#168) [39m [31m────[39m as.data.frame(tbl_1) not equal to as.data.frame(tbl_2). Component "ranking_def": names for target but not for current Component "ranking_od": names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 176 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 8 ] 1. Failure: rate_od works (@test-offense-defense.R#26) 2. Failure: rate_od works (@test-offense-defense.R#44) 3. Failure: rate_od handles factor player (@test-offense-defense.R#68) 4. Failure: rate_od handles numeric player (@test-offense-defense.R#91) 5. Failure: rank_od works (@test-offense-defense.R#114) 6. Failure: rank_od works (@test-offense-defense.R#127) 7. Failure: rank_od handles factor player (@test-offense-defense.R#148) 8. Failure: rank_od handles numeric player (@test-offense-defense.R#168)

Error: testthat unit tests failed Execution halted ```

concurve

Version: 2.3.0
Source code: https://github.com/cran/concurve
URL: https://data.lesslikely.com/concurve/, https://github.com/zadchow/concurve, https://lesslikely.com/
BugReports: https://github.com/zadchow/concurve/issues
Date/Publication: 2019-12-04 11:20:03 UTC
Number of recursive dependencies: 113

Run revdep_details(,"concurve") for more info

checking examples ... ERROR ``` Running examples in ‘concurve-Ex.R’ failed The error most likely occurred in:

Name: curve_corr

Title: Computes Consonance Intervals for Correlations

Aliases: curve_corr

** Examples

GroupA <- rnorm(50) GroupB <- rnorm(50) joe <- curve_corr(x = GroupA, y = GroupB, alternative = "two.sided", method = "pearson") tibble::tibble(joe[[1]]) Error: All columns in a tibble must be vectors: ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘MASS’ ‘compiler’ ‘rlang’ All declared Imports should be used.

corrr

Version: 0.4.0
Source code: https://github.com/cran/corrr
URL: https://github.com/tidymodels/corrr
BugReports: https://github.com/tidymodels/corrr/issues
Date/Publication: 2019-07-12 19:00:02 UTC
Number of recursive dependencies: 109

Run revdep_details(,"corrr") for more info

checking examples ... ERROR ``` ... > > x <- correlate(mtcars)

Correlation method: 'pearson' Missing treated using: 'pairwise.complete.obs'

x %>% focus_if(any_greater_than, .6) [38;5;246m# A tibble: 6 x 6[39m rowname mpg cyl disp hp wt [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [38;5;250m1[39m drat 0.681 -[31m0[39m[31m.[39m[31m700[39m -[31m0[39m[31m.[39m[31m710[39m -[31m0[39m[31m.[39m[31m449[39m -[31m0[39m[31m.[39m[31m712[39m [38;5;250m2[39m qsec 0.419 -[31m0[39m[31m.[39m[31m591[39m -[31m0[39m[31m.[39m[31m434[39m -[31m0[39m[31m.[39m[31m708[39m -[31m0[39m[31m.[39m[31m175[39m [38;5;250m3[39m vs 0.664 -[31m0[39m[31m.[39m[31m811[39m -[31m0[39m[31m.[39m[31m710[39m -[31m0[39m[31m.[39m[31m723[39m -[31m0[39m[31m.[39m[31m555[39m [38;5;250m4[39m am 0.600 -[31m0[39m[31m.[39m[31m523[39m -[31m0[39m[31m.[39m[31m591[39m -[31m0[39m[31m.[39m[31m243[39m -[31m0[39m[31m.[39m[31m692[39m [38;5;250m5[39m gear 0.480 -[31m0[39m[31m.[39m[31m493[39m -[31m0[39m[31m.[39m[31m556[39m -[31m0[39m[31m.[39m[31m126[39m -[31m0[39m[31m.[39m[31m583[39m [38;5;250m6[39m carb -[31m0[39m[31m.[39m[31m551[39m 0.527 0.395 0.750 0.428 x %>% focus_if(any_greater_than, .6, mirror = TRUE) %>% network_plot() Error in matrix_to_cells(j, x) : is_bare_logical(j) is not TRUE Calls: %>% ... tbl_subassign_matrix -> matrix_to_cells -> stopifnot Execution halted ```
checking tests ... `` ... [90m 1. [39mcorrr::as_cordf(retract(stretch(d))) [90m 4. [39mcorrr:::retract.data.frame(stretch(d)) [90mrevdep/checks/corrr/new/corrr.Rcheck/00_pkg_src/corrr/R/retract.R:16:2[39m [90m 5. [39mpurrr::map_dfr(...) [90mrevdep/checks/corrr/new/corrr.Rcheck/00_pkg_src/corrr/R/retract.R:25:2[39m [90m 6. [39mpurrr::map(.x, .f, ...) [90m 7. [39mcorrr:::.f(.x[[i]], ...) [90m 9. [39mtibble:::[.tbl_df`(.data, .data[, as_label(x)] == .x, ) [90mrevdep/checks/corrr/new/corrr.Rcheck/00_pkg_src/corrr/R/retract.R:27:6[39m [90m 10. [39mtibble:::tbl_subset_row(xo, i = i) [90m 11. [39mtibble:::vec_as_row_index(i, x) [90m 12. [39mvctrs::vec_as_index(i, nr)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 76 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 6 ] 1. Error: Diagonal sets correctly (@test-as_matrix.R#23) 2. Error: Network plot works (@test-plots.R#8) 3. Error: Rearrange return correct order (@test-rearrange.R#8) 4. Failure: Converts to proper structure (@test-rearrange.R#19) 5. Failure: Converts to proper structure (@test-stretch.R#12) 6. Error: retract works (@test-stretch.R#34)

Error: testthat unit tests failed Execution halted ```

cutpointr

Version: 1.0.1
Source code: https://github.com/cran/cutpointr
URL: https://github.com/thie1e/cutpointr
BugReports: https://github.com/thie1e/cutpointr/issues
Date/Publication: 2019-12-18 15:00:08 UTC
Number of recursive dependencies: 81

Run revdep_details(,"cutpointr") for more info

checking tests ... ``` ... names for target but not for current

[31m──[39m [31m12. Failure: boot_test works correctly (@test-cutpointr.R#1404) [39m [31m───────────────[39m btg$d not equal to bt$d. names for current but not for target

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 378 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 12 ] 1. Failure: Cutpointr returns a cutpointr without NAs and a certain Nr of rows (@test-cutpointr.R#11) 2. Failure: Correct cutpoints with example data (@test-cutpointr.R#239) 3. Failure: Correct cutpoints with example data (@test-cutpointr.R#240) 4. Failure: Results for constrained metrics are equal to results by OptimalCutpoints (@test-cutpointr.R#563) 5. Failure: Results for constrained metrics are equal to results by OptimalCutpoints (@test-cutpointr.R#564) 6. Failure: Results for constrained metrics are equal to results by OptimalCutpoints (@test-cutpointr.R#570) 7. Failure: Results for constrained metrics are equal to results by OptimalCutpoints (@test-cutpointr.R#571) 8. Failure: Main metric gets replaced correctly when ties are broken (@test-cutpointr.R#1023) 9. Failure: boot_ci works correctly (@test-cutpointr.R#1378) 1. ...

Error: testthat unit tests failed Execution halted ```

cvms

Version: 0.3.2
Source code: https://github.com/cran/cvms
URL: https://github.com/ludvigolsen/cvms
BugReports: https://github.com/ludvigolsen/cvms/issues
Date/Publication: 2019-12-01 23:10:02 UTC
Number of recursive dependencies: 114

Run revdep_details(,"cvms") for more info

checking tests ... ``` ... Lengths differ: 3 is not 2

[31m──[39m [31m11. Failure: model_verbose reports the correct model functions in validate() (@t[39m ...$NULL not equal to as.character(...). Lengths differ: 3 is not 2

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 1617 | SKIPPED: 12 | WARNINGS: 2 | FAILED: 11 ] 1. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#910) 2. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#923) 3. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#936) 4. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#948) 5. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#962) 6. Failure: model_verbose reports the correct model functions in cross_validate() (@test_cross_validate.R#975) 7. Failure: multinomial random predictions work with cross_validate_fn() (@test_cross_validate_fn.R#1448) 8. Failure: model_verbose reports the correct model functions in validate() (@test_validate.R#512) 9. Failure: model_verbose reports the correct model functions in validate() (@test_validate.R#523) 1. ...

Error: testthat unit tests failed Execution halted ```

diffdf

Version: 1.0.3
Source code: https://github.com/cran/diffdf
URL: https://github.com/gowerc/diffdf
BugReports: https://github.com/gowerc/diffdf/issues
Date/Publication: 2019-03-12 12:16:21 UTC
Number of recursive dependencies: 104

Run revdep_details(,"diffdf") for more info

checking tests ... ``` ...

[31m──[39m [31m19. Failure: (unknown) (@test-print_output.R#51) [39m [31m──────────────────────────────[39m RES[[i]] not equal to TESTING_print_msg[[i]]. Lengths differ: 186 is not 90 Reference = 21 - With 2 keys

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 549 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 19 ] 1. Failure: Unequal object, checking numbers correct (@test-core.R#186) 2. Failure: Unequal object, checking numbers correct (@test-core.R#187) 3. Failure: Unequal object, checking numbers correct (@test-core.R#188) 4. Failure: Unequal object, checking numbers correct (@test-core.R#189) 5. Failure: Unequal object, checking numbers correct (@test-core.R#190) 6. Failure: Unequal object, checking numbers correct (@test-core.R#191) 7. Failure: Unequal object, checking numbers correct (@test-core.R#192) 8. Failure: Unequal object, checking numbers correct (@test-core.R#193) 9. Failure: (unknown) (@test-print_output.R#51) 1. ...

Error: testthat unit tests failed Execution halted ```

drake

Version: 7.8.0
Source code: https://github.com/cran/drake
URL: https://github.com/ropensci/drake, https://docs.ropensci.org/drake, https://books.ropensci.org/drake/
BugReports: https://github.com/ropensci/drake/issues
Date/Publication: 2019-12-02 14:40:02 UTC
Number of recursive dependencies: 135

Run revdep_details(,"drake") for more info

checking tests ... ``` ... [31m──[39m [31m45. Failure: basic history (@test-history.R#96) [39m [31m───────────────────────────────[39m is.na(out$hash) not equal to !out$current. names for current but not for target

.══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 4950 | SKIPPED: 257 | WARNINGS: 0 | FAILED: 45 ] 1. Failure: cache functions work from various working directories (@test-cache.R#241) 2. Failure: cache functions work from various working directories (@test-cache.R#241) 3. Failure: 1 grouping level (@test-dsl.R#53) 4. Failure: all new crossings (@test-dsl.R#253) 5. Failure: 1 new map (@test-dsl.R#267) 6. Failure: 2 new maps (@test-dsl.R#281) 7. Failure: command symbols are for combine() but the plan has them (@test-dsl.R#315) 8. Failure: combine different groups together (@test-dsl.R#346) 9. Failure: multiple groups and multiple splits (@test-dsl.R#382) 1. ...

Error: testthat unit tests failed Execution halted Error while shutting down parallel: unable to terminate some child processes ```

egor

Version: 0.19.10
Source code: https://github.com/cran/egor
URL: https://github.com/tilltnet/egor, https://tilltnet.github.io/egor/
BugReports: https://github.com/tilltnet/egor/issues
Date/Publication: 2019-10-07 22:10:06 UTC
Number of recursive dependencies: 70

Run revdep_details(,"egor") for more info

checking examples ... ERROR ``` Running examples in ‘egor-Ex.R’ failed The error most likely occurred in:

Name: clustered_graphs

Title: Cluster ego-centered networks by a grouping factor

Aliases: clustered_graphs clustered_graphs.list clustered_graphs.egor

clustered_graphs.data.frame

Keywords: analysis ego-centered network

** Examples

data("egor32")

Simplify networks to clustered graphs, stored as igraph objects

graphs <- clustered_graphs(egor32, "country") Error: i must have one dimension, not 2. Execution halted ```
checking tests ... ``` ... Ego sampling design: NULL Alter survey design: Maximum nominations: EI-Index: age EI-Index: sex EI-Index: sex EI-Index: int_var EI-Index: female EI-Index: female ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 69 | SKIPPED: 0 | WARNINGS: 3 | FAILED: 6 ]
1. Failure: Methods are working. (@test_clustered_graphs.R#9)
2. Failure: Methods are working with partially missing data. (@test_clustered_graphs.R#23)
3. Failure: Methods work (properly) with NAs in grouping variable. (@test_clustered_graphs.R#35)
4. Error: Methods work (properly) with NAs in grouping variable. (@test_clustered_graphs.R#38)
5. Failure: Methods work (properly) with grouping variable being completly NA. (@test_clustered_graphs.R#52)
6. Error: Methods work (properly) with grouping variable being completly NA. (@test_clustered_graphs.R#55)
Error: testthat unit tests failed Execution halted ```

eph

Version: 0.2.0
Source code: https://github.com/cran/eph
URL: https://github.com/holatam/eph
BugReports: https://github.com/rindec/eph/issues
Date/Publication: 2019-11-26 22:40:02 UTC
Number of recursive dependencies: 122

Run revdep_details(,"eph") for more info

checking examples ... ERROR ... binding character and factor vector, coercing into character vector Warning in bind_rows_(x, .id) : binding character and factor vector, coercing into character vector > bases_clasif <- organize_ocupations(base = bases) Error: No common type for `..1$value` <character> and `..2$value` <double>. [1m<error/vctrs_error_incompatible_type>[22m No common type for `..1$value` <character> and `..2$value` <double>. [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─eph::organize_ocupations(base = bases) [90m 2. [39m│ └─`%>%`(...) [90m00_pkg_src/eph/R/organize_ocupations.R:21:2[39m [90m 3. [39m│ ├─base::withVisible(eval(quote(`_fseq`(`_lhs`)), env, env)) [90m 4. [39m│ └─base::eval(quote(`_fseq`(`_lhs`)), env, env) [90m 5. [39m│ └─base::eval(quote(`_fseq`(`_lhs`)), env, env) [90m 6. [39m│ └─eph:::`_fseq`(`_lhs`) [90m 7. [39m│ └─magrittr::freduce(value, `_function_list`) [90m 8. [39m│ ├─base::withVisible(function_list[[k]](value)) [90m 9. [39m│ └─function_list[[k]](value) [90m 10. [39m│ └─dplyr::add_row(., value = 99, CATEGORIA = "Ns.Nc") [90m 11. [39m│ Execution halted

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘readr’ ‘tidyverse’ All declared Imports should be used.
checking data for non-ASCII characters ... NOTE Note: found 114 marked UTF-8 strings

evaluator

Version: 0.4.1
Source code: https://github.com/cran/evaluator
URL: https://evaluator.tidyrisk.org
BugReports: https://github.com/davidski/evaluator/issues
Date/Publication: 2019-07-22 15:00:03 UTC
Number of recursive dependencies: 137

Run revdep_details(,"evaluator") for more info

checking examples ... ERROR ``` Running examples in ‘evaluator-Ex.R’ failed The error most likely occurred in:

Name: exposure_histogram

Title: Display a histogram of losses for a scenario

Aliases: exposure_histogram

** Examples

data(mc_simulation_results) result <- mc_simulation_results[[1, "results"]] exposure_histogram(result) Error: data must be a data frame, or other object coercible by fortify(), not a list Execution halted ```
checking tests ... ``` ... Expected match: "iteration" Actual message: "All scenarios must be tidyrisk_scenario objects" [1mBacktrace:[22m [90m 1. [39mtestthat::expect_error(...) [90m 6. [39mevaluator::run_simulations(good_scen, simulation_count = 10L)

[31m──[39m [31m6. Error: Simulation summary handles NAs for tc/diff exceedance (@test-summarize[39m [[ ]] improper number of subscripts

# Scenario model: openfair_tef_tc_diff_lm ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 128 | SKIPPED: 4 | WARNINGS: 12 | FAILED: 6 ] 1. Error: SR model works as expected (@test-openfair.R#220) 2. Error: Simulation respects maximum ALE (@test-simulate.R#21) 3. Failure: Missing mandatory OpenFAIR factors are detected (@test-simulate.R#29) 4. Failure: Bad scenario parameters throw an error (@test-simulate.R#36) 5. Failure: Multiple simulations deprecates the simulation_count parameters (@test-simulate.R#56) 6. Error: Simulation summary handles NAs for tc/diff exceedance (@test-summarize.R#17)

Error: testthat unit tests failed Execution halted ```

exuber

Version: 0.3.0
Source code: https://github.com/cran/exuber
URL: https://github.com/kvasilopoulos/exuber
BugReports: https://github.com/kvasilopoulos/exuber/issues
Date/Publication: 2019-07-15 09:40:07 UTC
Number of recursive dependencies: 89

Run revdep_details(,"exuber") for more info

checking tests ... `` ... > library(exuber) Registered S3 method overwritten by 'exuber': method from index.default zoo > > test_check("exuber") [31m──[39m [31m1. Failure: crit as data (@test-cv.R#4) [39m [31m───────────────────────────────────────[39mcapture.output(print(crit))threw an error. Message: Expected a vector, not alist/crit` object Class: vctrs_error_scalar_type/vctrs_error/rlang_error/error/condition [1mBacktrace:[22m [90m 1. [39mbase::print(crit) [90m 19. [39mvctrs:::stop_scalar_type(...) [90m 20. [39mvctrs:::stop_vctrs(msg, "vctrs_error_scalar_type", actual = x)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 258 | SKIPPED: 0 | WARNINGS: 1 | FAILED: 1 ] 1. Failure: crit as data (@test-cv.R#4)

Error: testthat unit tests failed Execution halted ```

checking installed package size ... NOTE installed size is 5.6Mb sub-directories of 1Mb or more: data 2.5Mb libs 2.5Mb

feasts

Version: 0.1.1
Source code: https://github.com/cran/feasts
URL: http://feasts.tidyverts.org/
BugReports: https://github.com/tidyverts/feasts/issues
Date/Publication: 2019-09-02 14:10:06 UTC
Number of recursive dependencies: 90

Run revdep_details(,"feasts") for more info

checking examples ... ERROR ``` ...
- Industry == "Cafes, restaurants and catering services"
- ) %>%
- model(ARIMA(Turnover ~ pdq(0,1,1) + PDQ(0,1,1))) %>%
- gg_arma()
- }
Attaching package: ‘dplyr’

The following object is masked from ‘package:tsibble’:
```
id
```
The following objects are masked from ‘package:stats’:
```
filter, lag
```
The following objects are masked from ‘package:base’:
```
intersect, setdiff, setequal, union
```
Error: All columns in a tibble must be vectors: ```
checking tests ... ``` ...
- Column fable::ARIMA(value ~ 0 + pdq(1, 1, 1) + PDQ(1, 1, 2)) is lst_mdl [1mBacktrace:[22m [90m 1. [39mfeasts::gg_arma(mdl) [90m 2. [39m%>%(...) [90mrevdep/checks/feasts/new/feasts.Rcheck/00_pkg_src/feasts/R/graphics.R:628:2[39m [90m 4. [39m[ base::eval(...) ][90m with 1 more call[39m [90m 6. [39mfeasts:::_fseq(_lhs) [90m 7. [39mmagrittr::freduce(value, _function_list) [90m 8. [39mfunction_list[i] [90m 10. [39mfabletools:::glance.mdl_df(.) [90m 12. [39mfabletools:::gather.mdl_df(...) [90m 15. [39mfabletools:::as_tibble.mdl_df(data) [90m 17. [39mtibble:::as_tibble.data.frame(x, ...) [90m 18. [39mtibble:::lst_to_tibble(unclass(x), .rows, .name_repair) [90m 19. [39mtibble:::check_valid_cols(x)
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 103 | SKIPPED: 0 | WARNINGS: 11 | FAILED: 1 ] 1. Error: gg_arma() plots (@test-graphics.R#253)

Error: testthat unit tests failed Execution halted ```

foieGras

Version: 0.4.0
Source code: https://github.com/cran/foieGras
URL: https://cran.r-project.org/package=foieGras
BugReports: https://github.com/ianjonsen/foieGras/issues
Date/Publication: 2019-10-07 22:10:03 UTC
Number of recursive dependencies: 101

Run revdep_details(,"foieGras") for more info

checking tests ... ``` ERROR Running the tests in ‘tests/testthat.R’ failed. Complete output: > library(testthat) > library(foieGras) > > test_check("foieGras")

pre-filtering data...

fitting SSM... [31m──[39m [31m1. Failure: plot completes silently (@test-osar.R#22) [39m [31m─────────────────────────[39m plot(r, "hist") produced warnings.

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 37 | SKIPPED: 14 | WARNINGS: 0 | FAILED: 1 ] 1. Failure: plot completes silently (@test-osar.R#22)

Error: testthat unit tests failed Execution halted ```

checking installed package size ... NOTE installed size is 43.4Mb sub-directories of 1Mb or more: libs 42.1Mb

forestmangr

Version: 0.9.1
Source code: https://github.com/cran/forestmangr
URL: https://github.com/sollano/forestmangr#readme
BugReports: https://github.com/sollano/forestmangr/issues
Date/Publication: 2019-01-02 23:10:27 UTC
Number of recursive dependencies: 114

Run revdep_details(,"forestmangr") for more info

checking examples ... ERROR `` ... 2:.key` is deprecated > > # This can also be done directly using "merge_est" as output: > nls_table(exfm14,dh ~ b0 * (1 - exp( -b1 * age ) )^b2,
- mod_start = tab_coef ,
- .groups = "strata",
- output = "merge_est",
- est.name = "dh_est" ) %>%
- mutate(
- bias = bias_per(y = dh, yhat = dh_est),
- rmse = rmse_per(y = dh, yhat = dh_est) ) %>%
- head(15) Error in -x : invalid argument to unary operator Calls: %>% ... -> vars_select_eval -> map_if -> map -> .f -> - In addition: Warning messages: 1: .key is deprecated 2: unnest() has a new interface. See ?unnest for details. Try df %>% unnest(c(est_n, data_n)), with mutate() if needed 3: unnest() has a new interface. See ?unnest for details. Try df %>% unnest(c(dat, est)), with mutate() if needed Execution halted ```

googlesheets4

Version: 0.1.0
Source code: https://github.com/cran/googlesheets4
URL: https://github.com/tidyverse/googlesheets4
BugReports: https://github.com/tidyverse/googlesheets4/issues
Date/Publication: 2019-11-04 21:50:02 UTC
Number of recursive dependencies: 65

Run revdep_details(,"googlesheets4") for more info

checking tests ... ``` ...

[31m──[39m [31m5. Error: can shim four sides (@test-utils-sheet-geometry.R#77) [39m [31m───────────────[39m No common type for ..1$cell and ..2$cell . [1mBacktrace:[22m [90m 1. [39mgooglesheets4:::expect_shim("A1:E4") [90m 18. [39mvctrs:::vec_ptype2.character.default(...) [90m 19. [39mvctrs::vec_default_ptype2(x, y, x_arg = x_arg, y_arg = y_arg) [90m 20. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 21. [39mvctrs:::stop_incompatible(...) [90m 22. [39mvctrs:::stop_vctrs(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 187 | SKIPPED: 4 | WARNINGS: 0 | FAILED: 5 ] 1. Error: can shim a single side (@test-utils-sheet-geometry.R#38) 2. Error: can shim two opposing sides (@test-utils-sheet-geometry.R#49) 3. Error: can shim on two perpendicular sides (@test-utils-sheet-geometry.R#56) 4. Error: can shim three sides (@test-utils-sheet-geometry.R#67) 5. Error: can shim four sides (@test-utils-sheet-geometry.R#77)

Error: testthat unit tests failed Execution halted ```

haven

Version: 2.2.0
Source code: https://github.com/cran/haven
URL: http://haven.tidyverse.org, https://github.com/tidyverse/haven, https://github.com/WizardMac/ReadStat
BugReports: https://github.com/tidyverse/haven/issues
Date/Publication: 2019-11-08 06:20:22 UTC
Number of recursive dependencies: 60

Run revdep_details(,"haven") for more info

checking Rd cross-references ... WARNING ``` Missing link or links in documentation object 'read_dta.Rd': ‘name-repair’

Missing link or links in documentation object 'read_sas.Rd': ‘name-repair’

Missing link or links in documentation object 'read_spss.Rd': ‘name-repair’

Missing link or links in documentation object 'read_xpt.Rd': ‘name-repair’

See section 'Cross-references' in the 'Writing R Extensions' manual. ```

checking installed package size ... NOTE installed size is 6.0Mb sub-directories of 1Mb or more: libs 5.5Mb
checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements.

healthcareai

Version: 2.3.0
Source code: https://github.com/cran/healthcareai
URL: http://docs.healthcare.ai
BugReports: https://github.com/HealthCatalyst/healthcareai-r/issues
Date/Publication: 2018-12-12 23:50:03 UTC
Number of recursive dependencies: 120

Run revdep_details(,"healthcareai") for more info

checking examples ... ERROR ``` ... > > ### ** Examples > > models <- machine_learn(pima_diabetes[1:40, ],
- patient_id,
- outcome = diabetes,
- models = c("XGB", "RF"),
- tune = FALSE,
- n_folds = 3) Training new data prep recipe...
The argument options is deprecated in favor of freq_cut and unique_cut. options` will be removed in next version. Variable(s) ignored in prep_data won't be used to tune models: patient_id

diabetes looks categorical, so training classification algorithms.

After data processing, models are being trained on 12 features with 40 observations. Based on n_folds = 3 and hyperparameter settings, the following number of models will be trained: 3 xgb's and 3 rf's

Training at fixed values: eXtreme Gradient Boosting Training at fixed values: Random Forest ```
checking tests ... ``` ... > if (!identical(Sys.getenv("NOT_CRAN"), "true")) {
- library(testthat)
- library(healthcareai)
- Sys.setenv("R_TESTS" = "")
- test_check("healthcareai", filter = "cran_only")
- } healthcareai version 2.3.0 Please visit https://docs.healthcare.ai for full documentation and vignettes. Join the community at https://healthcare-ai.slack.com [31m──[39m [31m1. Error: the fundamentals work (@test-cran_only.R#4) [39m [31m─────────────────────────[39m goal must be a vector, not a primitive function [1mBacktrace:[22m [90m 1. [39mhealthcareai::machine_learn(...) [90m 25. [39mvctrs:::stop_scalar_type(...) [90m 26. [39mvctrs:::stop_vctrs(msg, "vctrs_error_scalar_type", actual = x)
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 0 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 1 ] 1. Error: the fundamentals work (@test-cran_only.R#4)

Error: testthat unit tests failed Execution halted ```

heemod

Version: 0.11.0
Source code: https://github.com/cran/heemod
BugReports: https://github.com/pierucci/heemod/issues
Date/Publication: 2019-10-22 08:40:05 UTC
Number of recursive dependencies: 94

Run revdep_details(,"heemod") for more info

checking examples ... ERROR ``` Running examples in ‘heemod-Ex.R’ failed The error most likely occurred in:

Name: define_dsa

Title: Define a Sensitivity Analysis

Aliases: define_dsa define_dsa_

** Examples

define_dsa( + a, 10, 45, + b, .5, 1.5 + ) Error: All columns in a tibble must be vectors: ```
checking tests ... `` ... [90m 4. [39mheemod:::define_dsa_(...) [90mrevdep/checks/heemod/new/heemod.Rcheck/00_pkg_src/heemod/R/tabular_input.R:639:4[39m [90m 11. [39mtibble::tibble(dots[i]) [90m 12. [39mtibble:::tibble_quos(xs[!is_null], .rows, .name_repair) [90m 13. [39mtibble:::check_valid_col(res, col_names[[j]], j) [90m 14. [39mtibble:::check_valid_cols(list2(:=`(!!name, x)))

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 470 | SKIPPED: 0 | WARNINGS: 1 | FAILED: 12 ] 1. Error: Same results using 1 core or 2. (@test_parallel.R#7) 2. Failure: Parameter evaluation (@test_parameters.R#81) 3. Error: we can run construct_part_surv_tib (@test_part_surv.R#298) 4. Error: define sensitivity (@test_sensitivity.R#5) 5. Error: run sensitivity (@test_sensitivity.R#101) 6. Error: discount rate as a parameter works (@test_sensitivity.R#173) 7. Error: sensitivity expression inputs (@test_sensitivity.R#236) 8. Error: can read multinomial parameters from file (@test_tabular_input.R#110) 9. Failure: Bad parameter file input is caught. (@test_tabular_input.R#379) 1. ...

Error: testthat unit tests failed Execution halted ```

checking package dependencies ... NOTE Package suggested but not available for checking: ‘rgho’

INDperform

Version: 0.2.1
Source code: https://github.com/cran/INDperform
URL: https://github.com/saskiaotto/INDperform
BugReports: https://github.com/SaskiaAOtto/INDperform/issues
Date/Publication: 2019-07-13 23:20:03 UTC
Number of recursive dependencies: 86

Run revdep_details(,"INDperform") for more info

checking examples ... ERROR ``` Running examples in ‘INDperform-Ex.R’ failed The error most likely occurred in:

Name: merge_models

Title: Merging two model output tibbles.

Aliases: merge_models

** Examples

Using some models of the Baltic Sea demo data:

Merging GAM and GAMM tibbles

test_ids <- 47:50 # choose subset gam_tbl <- model_gam_ex[test_ids,] gamm_tbl <- model_gamm(ind_init_ex[test_ids,], filter= gam_tbl$tac) Error in model_gamm(ind_init_ex[test_ids, ], filter = gam_tbl$tac) : No IND~pressure GAMM could be fitted! Check if you chose the correct error distribution (default is gaussian()). Execution halted ```
checking tests ... ``` ... [90m 10. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 11. [39mvctrs:::stop_incompatible(...) [90m 12. [39mvctrs:::stop_vctrs(...)

[31m──[39m [31m3. Error: (unknown) (@test_test_interaction.R#27) [39m [31m─────────────────────────────[39m No common type for value and x . [1mBacktrace:[22m [90m 1. [39mbase::[<-(*tmp*, 1, -c(1:4), value = NA) [90m 8. [39mvctrs:::vec_ptype2.logical.list(...) [90m 9. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 10. [39mvctrs:::stop_incompatible(...) [90m 11. [39mvctrs:::stop_vctrs(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 506 | SKIPPED: 0 | WARNINGS: 29 | FAILED: 3 ] 1. Error: (unknown) (@test_model_gamm.R#4) 2. Error: (unknown) (@test_scoring.R#15) 3. Error: (unknown) (@test_test_interaction.R#27)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘lazyeval’ All declared Imports should be used.

interactions

Version: 1.1.1
Source code: https://github.com/cran/interactions
URL: https://interactions.jacob-long.com
BugReports: https://github.com/jacob-long/interactions/issues
Date/Publication: 2019-07-05 07:30:23 UTC
Number of recursive dependencies: 91

Run revdep_details(,"interactions") for more info

checking examples ... ERROR ... > ### Title: Plot interaction effects in regression models > ### Aliases: interact_plot > > ### ** Examples > > # Using a fitted lm model > states <- as.data.frame(state.x77) > states$HSGrad <- states$`HS Grad` > fit <- lm(Income ~ HSGrad + Murder * Illiteracy, data = states) > interact_plot(model = fit, pred = Murder, modx = Illiteracy) Error: Must extract with a single index. [31mx[39m `j` has the wrong type `symbol`. [34mℹ[39m This index must be a position or a name. Backtrace: [90m 1. [39minteractions::interact_plot(model = fit, pred = Murder, modx = Illiteracy) [90m 2. [39minteractions:::plot_mod_continuous(...) [90m00_pkg_src/interactions/R/interact_plot.R:424:2[39m [90m 5. [39mtibble:::`[[.tbl_df`(d, pred) [90m00_pkg_src/interactions/R/interact_plot.R:645:2[39m [90m 6. [39mtibble:::tbl_subset2(x, j = i) [90m 7. [39mvctrs::vec_as_position(j, length(x), names(x), arg = "j") [90m 8. [39mvctrs:::maybe_get(...) Execution halted
checking tests ... ``` ... [90m 11. [39mtibble:::tbl_subset2(x, j = i) [90m 12. [39mvctrs::vec_as_position(j, length(x), names(x), arg = "j") [90m 13. [39mvctrs:::maybe_get(...)

Failed with error: 'there is no package called 'brms'' Failed with error: 'there is no package called 'rstanarm'' ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 122 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 13 ] 1. Error: interact_plot works for lm (@test_interact_plot.R#33) 2. Error: interact_plot: robust standard errors work (@test_interact_plot.R#60) 3. Error: rug plots work (@test_interact_plot.R#70) 4. Error: interact_plot works for weighted lm (@test_interact_plot.R#90) 5. Error: interact_plot works for lm w/ logical (@test_interact_plot.R#100) 6. Error: interact_plot works for lm w/ non-focal character (@test_interact_plot.R#111) 7. Error: interact_plot accepts user-specified values and labels (@test_interact_plot.R#118) 8. Error: interact_plot terciles modxval/mod2val works (@test_interact_plot.R#140) 9. Error: interact_plot linearity.check works (@test_interact_plot.R#151) 1. ...

Error: testthat unit tests failed Execution halted ```

checking package dependencies ... NOTE Packages which this enhances but not available for checking: 'brms', 'rstanarm'
checking Rd cross-references ... NOTE Packages unavailable to check Rd xrefs: ‘quantreg’, ‘brms’, ‘effects’, ‘Hmisc’, ‘rockchalk’, ‘pequod’

janitor

Version: 1.2.0
Source code: https://github.com/cran/janitor
URL: https://github.com/sfirke/janitor
BugReports: https://github.com/sfirke/janitor/issues
Date/Publication: 2019-04-21 04:20:13 UTC
Number of recursive dependencies: 60

Run revdep_details(,"janitor") for more info

checking examples ... ERROR ``` ... > # calculates correctly even with totals column and/or row: > mtcars %>%
- tabyl(am, cyl) %>%
- adorn_totals("row") %>%
- adorn_percentages() Error: No common type for value and x . [1m[22m No common type for value and x . [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─mtcars %>% tabyl(am, cyl) %>% adorn_totals("row") %>% adorn_percentages() [90m 2. [39m│ ├─base::withVisible(eval(quote(_fseq(_lhs)), env, env)) [90m 3. [39m│ └─base::eval(quote(_fseq(_lhs)), env, env) [90m 4. [39m│ └─base::eval(quote(_fseq(_lhs)), env, env) [90m 5. [39m│ └─_fseq(_lhs) [90m 6. [39m│ └─magrittr::freduce(value, _function_list) [90m 7. [39m│ └─function_list[i] [90m 8. [39m│ └─janitor::adorn_totals(., "row") [90m 9. [39m│ ├─base::[<-(*tmp*, 1, 1, value = "Total") [90m00_pkg_src/janitor/R/adorn_totals.R:67:6[39m [90m 10. [39m│ └─tibble:::[<-.tbl_df(*tmp*, 1, 1, value = "Total") [90 Execution halted ```
checking tests ... ``` ... [90m 29. [39mvctrs:::vec_ptype2.character.default(...) [90m 30. [39mvctrs::vec_default_ptype2(x, y, x_arg = x_arg, y_arg = y_arg) [90m 31. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 32. [39mvctrs:::stop_incompatible(...) [90m 33. [39mvctrs:::stop_vctrs(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 522 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 12 ] 1. Error: grouped_df gets ungrouped and succeeds (@test-add-totals.R#122) 2. Error: na.rm value works correctly (@test-add-totals.R#129) 3. Error: add_totals respects if input was data.frame (@test-add-totals.R#141) 4. Error: add_totals respects if input was data_frame (@test-add-totals.R#148) 5. Error: works with non-numeric columns mixed in; fill character specification (@test-add-totals.R#192) 6. Error: automatically invokes purrr::map when called on a 3-way tabyl (@test-add-totals.R#251) 7. Error: deprecated functions adorn_totals_col and adorn_totals_row function as expected (@test-add-totals.R#283) 8. Error: (unknown) (@test-adorn-percentages.R#44) 9. Error: non-tabyls are treated correctly (@test-adorn-title.R#49) 1. ...

Error: testthat unit tests failed Execution halted ```

jstor

Version: 0.3.7
Source code: https://github.com/cran/jstor
URL: https://github.com/ropensci/jstor, https://ropensci.github.io/jstor/
BugReports: https://github.com/ropensci/jstor/issues
Date/Publication: 2019-09-05 02:10:11 UTC
Number of recursive dependencies: 69

Run revdep_details(,"jstor") for more info

checking examples ... ERROR ``` Running examples in ‘jstor-Ex.R’ failed The error most likely occurred in:

Name: jst_define_import

Title: Define an import specification

Aliases: jst_define_import

** Examples

articles will be imported via jst_get_article() and jst_get_authors()

jst_define_import(article = c(jst_get_article, jst_get_authors)) Error: All columns in a tibble must be vectors: ```
checking tests ... `` ... [1mBacktrace:[22m [90m 1. [39mtestthat::expect_error(...) [90m 10. [39mjstor::jst_define_import(article = jst_get_article) [90m 11. [39mtibble::tibble(...) [90mrevdep/checks/jstor/new/jstor.Rcheck/00_pkg_src/jstor/R/import_spec.R:170:2[39m [90m 12. [39mtibble:::tibble_quos(xs[!is_null], .rows, .name_repair) [90m 13. [39mtibble:::check_valid_col(res, col_names[[j]], j) [90m 14. [39mtibble:::check_valid_cols(list2(:=`(!!name, x)))

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 227 | SKIPPED: 4 | WARNINGS: 3 | FAILED: 8 ] 1. Failure: authors are correct (@test-books.R#117) 2. Error: jst_define_import returns correct class (@test-import-spec.R#4) 3. Error: jst_define_import validates input (@test-import-spec.R#11) 4. Error: jst_define_imports gives correct results (@test-import-spec.R#46) 5. Error: subsetting ngrams works (@test-ngram.R#32) 6. Error: importing from zip works (@test-zip.R#29) 7. Failure: too many arguments for batches throw error (@test-zip.R#56) 8. Failure: wrong row selection raises an error (@test-zip.R#68)

Error: testthat unit tests failed Execution halted ```

jtools

Version: 2.0.1
Source code: https://github.com/cran/jtools
URL: https://jtools.jacob-long.com
BugReports: https://github.com/jacob-long/jtools/issues
Date/Publication: 2019-04-08 21:30:11 UTC
Number of recursive dependencies: 128

Run revdep_details(,"jtools") for more info

checking examples ... ERROR `` ... > ### Aliases: effect_plot > > ### ** Examples > > # Using a fitted lm model > states <- as.data.frame(state.x77) > states$HSGrad <- states$HS Grad` > fit <- lm(Income ~ HSGrad + Murder,
- data = states)
  
  effect_plot(model = fit, pred = Murder) Error: Must extract with a single index. [31mx[39m j has the wrong type symbol. [34mℹ[39m This index must be a position or a name. Backtrace: [90m 1. [39mjtools::effect_plot(model = fit, pred = Murder) [90m 2. [39mjtools:::plot_effect_continuous(...) [90m00_pkg_src/jtools/R/effect_plot.R:291:4[39m [90m 5. [39mtibble:::[[.tbl_df(d, pred) [90m00_pkg_src/jtools/R/effect_plot.R:390:2[39m [90m 6. [39mtibble:::tbl_subset2(x, j = i) [90m 7. [39mvctrs::vec_as_position(j, length(x), names(x), arg = "j") [90m 8. [39mvctrs:::maybe_get(...) Execution halted ```
checking tests ... ``` ... [90m 11. [39mtibble:::tbl_subset2(x, j = i) [90m 12. [39mvctrs::vec_as_position(j, length(x), names(x), arg = "j") [90m 13. [39mvctrs:::maybe_get(...)

Failed with error: 'there is no package called 'brms'' Failed with error: 'there is no package called 'rstanarm'' ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 279 | SKIPPED: 0 | WARNINGS: 29 | FAILED: 11 ] 1. Error: effect_plot works for lm (@test-effect-plot.R#25) 2. Error: effect_plot: robust intervals works (@test-effect-plot.R#37) 3. Error: effect_plot: rug plots work (@test-effect-plot.R#45) 4. Error: effect_plot: plot.points works (@test-effect-plot.R#59) 5. Error: effect_plot: partial residuals work (@test-effect-plot.R#74) 6. Error: effect_plot works for weighted lm (@test-effect-plot.R#89) 7. Error: effect_plot works for svyglm (@test-effect-plot.R#134) 8. Error: effect_plot works for lme4 (@test-effect-plot.R#165) 9. Error: effect_plot handles offsets (@test-effect-plot.R#206) 1. ...

Error: testthat unit tests failed Execution halted ```

checking package dependencies ... NOTE Packages which this enhances but not available for checking: 'brms', 'quantreg', 'rstanarm'
checking Rd cross-references ... NOTE Packages unavailable to check Rd xrefs: ‘wec’, ‘quantreg’, ‘brms’, ‘arm’, ‘interactions’, ‘effects’, ‘piecewiseSEM’

keyholder

Version: 0.1.3
Source code: https://github.com/cran/keyholder
URL: https://echasnovski.github.io/keyholder/, https://github.com/echasnovski/keyholder/
BugReports: https://github.com/echasnovski/keyholder/issues/
Date/Publication: 2018-12-01 17:10:03 UTC
Number of recursive dependencies: 57

Run revdep_details(,"keyholder") for more info

checking tests ... `` ... > test_check("keyholder") [31m──[39m [31m1. Failure: add_id works on grouped_df (@test-id.R#46) [39m [31m────────────────────────[39moutput_1not identical tooutput_ref_1`. Objects equal but not identical

[31m──[39m [31m2. Failure: key_by_id works on grouped_df (@test-id.R#85) [39m [31m─────────────────────[39m output_1 not identical to output_ref_1. Objects equal but not identical

[31m──[39m [31m3. Failure: key_by_id works on grouped_df (@test-id.R#108) [39m [31m────────────────────[39m output_3 not identical to output_ref_3. Objects equal but not identical

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 306 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 3 ] 1. Failure: add_id works on grouped_df (@test-id.R#46) 2. Failure: key_by_id works on grouped_df (@test-id.R#85) 3. Failure: key_by_id works on grouped_df (@test-id.R#108)

Error: testthat unit tests failed Execution halted ```

metacoder

Version: 0.3.3
Source code: https://github.com/cran/metacoder
URL: https://grunwaldlab.github.io/metacoder_documentation/
BugReports: https://github.com/grunwaldlab/metacoder/issues
Date/Publication: 2019-07-18 06:35:33 UTC
Number of recursive dependencies: 145

Run revdep_details(,"metacoder") for more info

checking tests ... `` ... > test_check("metacoder") [31m──[39m [31m1. Failure: Summing counts per taxon (@test--calculations.R#103) [39m [31m──────────────[39m sum(x$data$tax_data$700035949) not equal to result$700035949`[1]. names for current but not for target

[31m──[39m [31m2. Failure: Summing counts per taxon (@test--calculations.R#126) [39m [31m──────────────[39m total_counts not equal to result$total[1]. names for current but not for target

[31m──[39m [31m3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_writers.[39m result$data$tax_data$unite_seq[5] not equal to "CCAAATCATGTCTCCCGGCCGCAAGGCAGGTGCAGGCGTTTAACCCTTTGTGAACCAAAAAACCTTTCGCTTCGGCAGCAGCTCGGTTGGAGACAGCCTCTGTGTCAGCCTGCCGCTAGCACCAATTATCAAAACTTGCGGTTAGCAACATTGTCTGATTACCAAATTTTCGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCATTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCGGTCACCACCGGTTTTGAGCGAGCAGGGTCTTCGGATCCAGCTGGCTTTAAAGTTGTAAGCTCTGCTGGCTGCTCGGCCCAACCAGAACATAGTAAAATCATGCTTGTTCAAGGTTCGCGGTCGAAGCGGTACGGCCTGAACAATACCTACCACCTCTTAGG". names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 93 | SKIPPED: 1 | WARNINGS: 0 | FAILED: 3 ] 1. Failure: Summing counts per taxon (@test--calculations.R#103) 2. Failure: Summing counts per taxon (@test--calculations.R#126) 3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_writers.R#119)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘ggrepel’ ‘reshape’ ‘svglite’ All declared Imports should be used.

MNLpred

Version: 0.0.1
Source code: https://github.com/cran/MNLpred
Date/Publication: 2019-11-05 15:20:09 UTC
Number of recursive dependencies: 64

Run revdep_details(,"MNLpred") for more info

checking examples ... ERROR ``` ... > ### ** Examples > > library(nnet) > library(MASS) > > dataset <- data.frame(y = c(rep("a", 10), rep("b", 10), rep("c", 10)),
- x1 = rnorm(30),
- x2 = rnorm(30, mean = 1),
- x3 = sample(1:10, 30, replace = TRUE))
  
  mod <- multinom(y ~ x1 + x2 + x3, data = dataset, Hess = TRUE)
weights: 15 (8 variable)

initial value 32.958369 iter 10 value 30.528006 final value 30.525569 converged

fdi1 <- mnl_fd2_ova(model = mod, data = dataset, + xvari = "x1", + value1 = min(dataset$x1), value2 = max(dataset$x1)) Error: Lossy cast from value to x . ```
checking tests ... `` ... # weights: 21 (12 variable) initial value 219.722458 iter 10 value 189.686272 final value 168.079235 converged [31m──[39m [31m1. Error: mnl_pred_ova() returns two predictions when by = NULL (@test_inputvari[39m Lossy cast fromvalue<double> tox` .
- Locations: 1, 2 [1mBacktrace:[22m [90m 1. [39mtestthat::expect_equal(...) [90m 12. [39mvctrs:::vec_cast.logical.double(...) [90m 13. [39mvctrs::maybe_lossy_cast(out, x, to, lossy, x_arg = x_arg, to_arg = to_arg) [90m 17. [39mvctrs:::stop_lossy_cast(...) [90m 18. [39mvctrs:::stop_vctrs(...)
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 0 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 1 ] 1. Error: mnl_pred_ova() returns two predictions when by = NULL (@test_inputvariants.R#17)

Error: testthat unit tests failed Execution halted ```

MPTmultiverse

Version: 0.3-3
Source code: https://github.com/cran/MPTmultiverse
URL: https://github.com/mpt-network/MPTmultiverse
BugReports: https://github.com/mpt-network/MPTmultiverse/issues
Date/Publication: 2019-08-27 23:30:29 UTC
Number of recursive dependencies: 88

Run revdep_details(,"MPTmultiverse") for more info

checking tests ... ``` ... target is NULL, current is numeric

[31m──[39m [31m16. Failure: No-pooling approaches work (@test-mptinr.R#136) [39m [31m──────────────────[39m only_npb$est_indiv[[1]]$se not equal to c(...). target is NULL, current is numeric

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 19 | SKIPPED: 3 | WARNINGS: 14 | FAILED: 16 ] 1. Failure: No-pooling approaches work (@test-mptinr.R#61) 2. Failure: No-pooling approaches work (@test-mptinr.R#62) 3. Failure: No-pooling approaches work (@test-mptinr.R#63) 4. Failure: No-pooling approaches work (@test-mptinr.R#68) 5. Failure: No-pooling approaches work (@test-mptinr.R#73) 6. Failure: No-pooling approaches work (@test-mptinr.R#78) 7. Failure: No-pooling approaches work (@test-mptinr.R#84) 8. Failure: No-pooling approaches work (@test-mptinr.R#92) 9. Failure: No-pooling approaches work (@test-mptinr.R#107) 1. ...

Error: testthat unit tests failed Execution halted ```

OncoBayes2

Version: 0.5-8
Source code: https://github.com/cran/OncoBayes2
Date/Publication: 2019-12-12 14:50:02 UTC
Number of recursive dependencies: 83

Run revdep_details(,"OncoBayes2") for more info

checking tests ... ``` ...

Population heterogeniety posterior tau_log_beta intercept: mean se_mean sd 2.5% 50% 97.5% n_eff Rhat 0.74 1.02 0.79 0.21 0.74 1.27 0.60 Inf log-slope: mean se_mean sd 2.5% 50% 97.5% n_eff Rhat 0.2644 0.0024 0.0019 0.2631 0.2644 0.2657 0.6021 Inf

Population correlation posterior rho_log_beta mean se_mean sd 2.5% 50% 97.5% n_eff Rhat I(log(drug1/1)) 0.088 0.44 0.34 -0.14 0.088 0.32 0.6 Inf

No interaction model posterior specified. Error in na.fail.default(X[[i]], ...) : missing values in object ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 130 | SKIPPED: 4 | WARNINGS: 162 | FAILED: 1 ] 1. Error: update.blrmfit grows the data set (@test-blrm_exnex.R#264)

Error: testthat unit tests failed Execution halted ```

checking installed package size ... NOTE installed size is 48.7Mb sub-directories of 1Mb or more: libs 47.3Mb
checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements.

oppr

Version: 0.0.4
Source code: https://github.com/cran/oppr
URL: https://prioritizr.github.io/oppr, https://github.com/prioritizr/oppr
BugReports: https://github.com/prioritizr/oppr/issues
Date/Publication: 2019-08-10 22:30:07 UTC
Number of recursive dependencies: 95

Run revdep_details(,"oppr") for more info

checking tests ... ``` ...

Excellent numeric accuracy ||*|| = 1.11022e-16

MEMO: lp_solve version 5.5.2.0 for 64 bit OS, with 64 bit LPSREAL variables. In the total iteration count 29, 4 (13.8%) were bound flips. There were 5 refactorizations, 0 triggered by time and 0 by density. ... on average 5.0 major pivots per refactorization. The largest [LUSOL v2.2.1.0] fact(B) had 58 NZ entries, 1.1x largest basis. The maximum B&B level was 4, 0.1x MIP order, 3 at the optimal solution. The constraint matrix inf-norm is 1, with a dynamic range of 10. Time to load data was 0.031 seconds, presolve used 0.000 seconds, ... 0.001 seconds in simplex solver, in total 0.032 seconds. ══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 1479 | SKIPPED: 35 | WARNINGS: 0 | FAILED: 4 ] 1. Failure: valid arguments (@test_project_cost_effectiveness.R#27) 2. Failure: valid arguments (@test_project_cost_effectiveness.R#36) 3. Failure: valid arguments (different number of actions/projects (@test_project_cost_effectiveness.R#63) 4. Failure: valid arguments (different number of actions/projects (@test_project_cost_effectiveness.R#69)

Error: testthat unit tests failed Execution halted ```

checking package dependencies ... NOTE Package suggested but not available for checking: ‘gurobi’
checking installed package size ... NOTE installed size is 19.3Mb sub-directories of 1Mb or more: R 3.9Mb libs 14.3Mb

pkgsearch

Version: 3.0.2
Source code: https://github.com/cran/pkgsearch
URL: https://github.com/r-hub/pkgsearch, https://r-hub.github.io/pkgsearch
BugReports: https://github.com/r-hub/pkgsearch/issues
Date/Publication: 2019-12-19 18:50:06 UTC
Number of recursive dependencies: 67

Run revdep_details(,"pkgsearch") for more info

checking examples ... ERROR ``` ... 10 19 vcd 1.4.4 David Meyer 2y Visualizing Categorical Data > ps()
- "visualization" ---------------------------- 1075 packages in 0.007 seconds -
Error: Expected a vector, not a package_version/numeric_version object [1m[22m Expected a vector, not a package_version/numeric_version object [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─(if (getRversion() >= "3.4") withAutoprint else force)(...) [90m 2. [39m│ └─base::source(...) [90m 3. [39m│ ├─base::print(yy$value) [90m 4. [39m│ └─pkgsearch:::print.pkg_search_result(yy$value) [90m 5. [39m│ └─pkgsearch:::cat_hit(x, i) [90m00_pkg_src/pkgsearch/R/print.R:57:4[39m [90m 6. [39m│ ├─x[no, ] [90m00_pkg_src/pkgsearch/R/print.R:68:2[39m [90m 7. [39m│ ├─pkgsearch:::[.pkg_search_result(x, no, ) [90m00_pkg_src/pkgsearch/R/print.R:68:2[39m [90m 8. [39m│ ├─base::NextMethod("[") [90m00_pkg_src/pkgsearch/R/api.R:296:2[39m [90m 9. [39m│ └─tibble:::[.tbl_df(x, no, ) [90m 10. [39m│ └─tibble:::tbl_subset_row(xo, i = i) [ Execution halted ```

pmdplyr

Version: 0.3.0
Source code: https://github.com/cran/pmdplyr
URL: https://nickch-k.github.io/pmdplyr, https://github.com/NickCH-K/pmdplyr
BugReports: https://github.com/NickCH-K/pmdplyr/issues
Date/Publication: 2019-08-26 09:50:02 UTC
Number of recursive dependencies: 106

Run revdep_details(,"pmdplyr") for more info

checking examples ... ERROR ``` ... > # Let's only use nonmissing earnings > # And let's say we're only interested in four-year colleges in Colorado > # (mutate_cascade + tlag can be very slow so we're working with a smaller sample) > Scorecard <- Scorecard %>%
- dplyr::filter(
- !is.na(earnings_med),
- pred_degree_awarded_ipeds == 3,
- state_abbr == "CO"
- ) %>%
- And declare the panel structure
- as_pibble(.i = unitid, .t = year)
  
  Scorecard <- Scorecard %>%
- Almost all instances involve a variable being set to a function of a lag of itself
- we don't want to overwrite so let's make another
- dplyr::mutate(decay_earnings = earnings_med) %>%
- Now we can cascade
- mutate_cascade(
- decay_earnings = decay_earnings +
- .5 * tlag(decay_earnings, .quick = TRUE)
- ) Error: Lossy cast from value to x . ```
checking tests ... `` ... inexact_anti_join(...) not equal to last_join %>% dplyr::select(-b) %>% dplyr::filter(FALSE). Incompatible type for columnt2`: x logical, y numeric

[31m──[39m [31m4. Failure: Different inexact joins work (@test-inexact_join.R#206) [39m [31m───────────[39m inexact_semi_join(left, right, var = t, jvar = t2, method = "last") not equal to last_join %>% dplyr::select(-b). Incompatible type for column t2: x logical, y numeric

[31m──[39m [31m5. Failure: Different inexact joins work (@test-inexact_join.R#213) [39m [31m───────────[39m inexact_anti_join(left, right, var = t, jvar = t2, method = "last") not equal to last_join %>% dplyr::select(-b) %>% dplyr::filter(FALSE). Incompatible type for column t2: x logical, y numeric

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 296 | SKIPPED: 0 | WARNINGS: 16 | FAILED: 5 ] 1. Error: inexact_join input failstates (@test-bad_input.R#96) 2. Failure: Different inexact joins work (@test-inexact_join.R#162) 3. Failure: Different inexact joins work (@test-inexact_join.R#169) 4. Failure: Different inexact joins work (@test-inexact_join.R#206) 5. Failure: Different inexact joins work (@test-inexact_join.R#213)

Error: testthat unit tests failed Execution halted ```

PML

Version: 1.1
Source code: https://github.com/cran/PML
URL: https://github.com/xinyue-L/PML
BugReports: https://github.com/xinyue-L/PML/issues
Date/Publication: 2019-09-17 08:00:02 UTC
Number of recursive dependencies: 85

Run revdep_details(,"PML") for more info

checking examples ... ERROR ... Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Warning in structure(x, class = unique(c("AsIs", oldClass(x)))) : Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes. Consider 'structure(list(), *)' instead. Error: All columns in a tibble must be vectors:

projects

Version: 2.0.0
Source code: https://github.com/cran/projects
URL: https://www.github.com/NikKrieger/projects
Date/Publication: 2019-09-05 16:10:03 UTC
Number of recursive dependencies: 98

Run revdep_details(,"projects") for more info

checking examples ... ERROR ``` ...

New author's affiliations: [38;5;246m# A tibble: 4 x 4[39m affiliation_id department_name institution_name address [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [38;5;250m1[39m 1 Math Dept. Springfield College 123 College St, Spri… [38;5;250m2[39m 42 Art Department Springfield College 321 University Boule… [38;5;250m3[39m 2 Central Intelligence… United States Gove… 888 Classified Dr, W… [38;5;250m4[39m 3 Pyrotechnics ACME [31mNA[39m

new_project(title = "Test project 1", current_owner = "Plato", stage = 1) [38;5;246m# A tibble: 3 x 7[39m id given_names last_name title degree email phone [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [38;5;250m1[39m 13 Spiro Agnew [31mNA[39m LLB [31mNA[39m [31mNA[39m [38;5;250m2[39m 303 Plato [31mNA[39m [31mNA[39m [31mNA[39m [31mNA[39m [31mNA[39m [38;5;250m3[39m 1 Condoleezza Rice [31mNA[39m [31mNA[39m [31mNA[39m [31mNA[39m Error in validate_unique_entry(x = x, table = authors_table, what = "author", :

The entry NA matches multiple authors, seen above. Calls: new_project ... validate_special_authors -> lapply -> FUN -> validate_unique_entry Execution halted ```
checking tests ... ``` ... [90m 18. [39mprojects:::FUN(X[[i]], ...) [90m 19. [39mprojects:::validate_unique_entry(...) [90mrevdep/checks/projects/new/projects.Rcheck/00_pkg_src/projects/R/class-projects_author.R:115:2[39m

[31m──[39m [31m4. Error: Setup works (@test-setup.R#183) [39m [31m─────────────────────────────────────[39m No common type for current_owner and current_owner . [1mBacktrace:[22m [90m 1. [39mtestthat::expect_identical(...) [90m 10. [39mvctrs:::vec_ptype2.default(x = x, y = y, x_arg = x_arg, y_arg = y_arg) [90m 11. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 12. [39mvctrs:::stop_incompatible(...) [90m 13. [39mvctrs:::stop_vctrs(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 14 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 4 ] 1. Failure: Setup works (@test-setup.R#129) 2. Failure: Setup works (@test-setup.R#147) 3. Failure: Setup works (@test-setup.R#157) 4. Error: Setup works (@test-setup.R#183)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘methods’ All declared Imports should be used.

psychmeta

Version: 2.3.4
Source code: https://github.com/cran/psychmeta
BugReports: https://github.com/psychmeta/psychmeta/issues
Date/Publication: 2019-12-19 17:20:02 UTC
Number of recursive dependencies: 80

Run revdep_details(,"psychmeta") for more info

checking examples ... ERROR ``` ...
- rxxi = c(.8, .7), n_rxxi = c(50, 150),
- ux = c(.9, .8), ni_ux = c(50, 150)) Taylor-Series Artifact Distributions
```
      mean   var var_res
```
qxa_irr 0.905 0.001 0.001 qxa_drr 0.905 0.001 0.001 qxi_irr 0.856 0.002 0.001 qxi_drr 0.856 0.002 0.001 rxxa_irr 0.819 0.003 0.002 rxxa_drr 0.819 0.003 0.002 rxxi_irr 0.734 0.006 0.004 rxxi_drr 0.734 0.006 0.004 ux 0.825 0.004 0.000 ut 0.781 0.005 0.000

create_ad(ad_type = "int", rxxa = c(.9, .8), n_rxxa = c(50, 150), + rxxi = c(.8, .7), n_rxxi = c(50, 150), + ux = c(.9, .8), ni_ux = c(50, 150)) Error: All columns in a tibble must be vectors: ```

rbin

Version: 0.1.1
Source code: https://github.com/cran/rbin
URL: https://github.com/rsquaredacademy/rbin, https://rbin.rsquaredacademy.com
BugReports: https://github.com/rsquaredacademy/rbin/issues
Date/Publication: 2019-01-04 11:20:04 UTC
Number of recursive dependencies: 133

Run revdep_details(,"rbin") for more info

checking examples ... ERROR ``` Running examples in ‘rbin-Ex.R’ failed The error most likely occurred in:

Name: rbin_create

Title: Create dummy variables

Aliases: rbin_create

** Examples

k <- rbin_manual(mbank, y, age, c(29, 39, 56)) rbin_create(mbank, age, k) New names: ```
checking tests ... ``` ... Predictor education Levels 4 Count 4521 Goods 517 Bads 4004 Entropy 0.51 Information Value 0.05

# A tibble: 4 x 7 level bin_count good bad woe iv entropy 1 tertiary 1299 195 1104 -0.313 0.0318 0.610 2 secondary 2352 231 2121 0.170 0.0141 0.463 3 unknown 179 25 154 -0.229 0.00227 0.583 4 primary 691 66 625 0.201 0.00572 0.455══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 10 | SKIPPED: 5 | WARNINGS: 0 | FAILED: 1 ] 1. Error: output from rbin_create is as expected as expected (@test-bins.R#30)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘utils’ All declared Imports should be used.

readwritesqlite

Version: 0.0.2
Source code: https://github.com/cran/readwritesqlite
URL: https://github.com/poissonconsulting/readwritesqlite
BugReports: https://github.com/poissonconsulting/readwritesqlite/issues
Date/Publication: 2019-07-23 16:50:02 UTC
Number of recursive dependencies: 71

Run revdep_details(,"readwritesqlite") for more info

checking tests ... `` ... > > test_check("readwritesqlite") [31m──[39m [31m1. Failure: initialized even with no rows of data (@test-write.R#592) [39m [31m─────────[39mremotenot identical tolocal`. Component "geometry": Attributes: < Names: 3 string mismatches > Component "geometry": Attributes: < Length mismatch: comparison on first 5 components > Component "geometry": Attributes: < Component "bbox": Attributes: < Length mismatch: comparison on first 1 components > > Component "geometry": Attributes: < Component "bbox": 'is.NA' value mismatch: 0 in current 4 in target > Component "geometry": Attributes: < Component "class": 1 string mismatch > Component "geometry": Attributes: < Component 3: Modes: character, list > Component "geometry": Attributes: < Component 3: Lengths: 0, 2 > Component "geometry": Attributes: < Component 3: names for current but not for target > Component "geometry": Attributes: < Component 3: Attributes: < target is NULL, current is list > > ...

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 443 | SKIPPED: 0 | WARNINGS: 27 | FAILED: 1 ] 1. Failure: initialized even with no rows of data (@test-write.R#592)

Error: testthat unit tests failed Execution halted ```

REDCapR

Version: 0.10.2
Source code: https://github.com/cran/REDCapR
URL: https://github.com/OuhscBbmc/REDCapR, http://ouhsc.edu/bbmc/, http://project-redcap.org
BugReports: https://github.com/OuhscBbmc/REDCapR/issues
Date/Publication: 2019-09-23 04:30:02 UTC
Number of recursive dependencies: 116

Run revdep_details(,"REDCapR") for more info

checking tests ... ``` ERROR Running the tests in ‘tests/test-all.R’ failed. Complete output: > # Modeled after the R6 testing structure: https://github.com/wch/R6/blob/master/tests/testthat.R > library(testthat) > library(REDCapR) > > testthat::test_check("REDCapR") [31m──[39m [31m1. Failure: validate_no_logical -concern dataset (@test-validate.R#36) [39m [31m────────[39m ds$field_index not equal to 2. names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 135 | SKIPPED: 79 | WARNINGS: 0 | FAILED: 1 ] 1. Failure: validate_no_logical -concern dataset (@test-validate.R#36)

Error: testthat unit tests failed Execution halted ```

rematch2

Version: 2.1.0
Source code: https://github.com/cran/rematch2
URL: https://github.com/r-lib/rematch2#readme
BugReports: https://github.com/r-lib/rematch2/issues
Date/Publication: 2019-07-11 17:32:41 UTC
Number of recursive dependencies: 41

Run revdep_details(,"rematch2") for more info

checking examples ... ERROR ... > pos <- re_exec(notables, name_rex) > pos Error: Expected a vector, not a `rematch_records` object [1m<error/vctrs_error_scalar_type>[22m Expected a vector, not a `rematch_records` object [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─(function (x, ...) ... [90m 2. [39m├─tibble:::print.tbl(x) [90m 3. [39m│ ├─tibble:::cat_line(format(x, ..., n = n, width = width, n_extra = n_extra)) [90m 4. [39m│ │ ├─base::cat(paste0(..., "\n"), sep = "") [90m 5. [39m│ │ └─base::paste0(..., "\n") [90m 6. [39m│ ├─base::format(x, ..., n = n, width = width, n_extra = n_extra) [90m 7. [39m│ └─tibble:::format.tbl(x, ..., n = n, width = width, n_extra = n_extra) [90m 8. [39m│ └─tibble::trunc_mat(x, n = n, width = width, n_extra = n_extra) [90m 9. [39m│ ├─base::as.data.frame(head(x, n)) [90m 10. [39m│ ├─utils::head(x, n) [90m 11. [39m│ └─utils:::head.data.frame(x, n) [90m 12. [39m│ ├─x[seq_len(n), , drop = FALSE] [90m Execution halted
checking tests ... ``` ... [90m 8. [39mvctrs:::stop_scalar_type(...) [90m 9. [39mvctrs:::stop_vctrs(msg, "vctrs_error_scalar_type", actual = x)

[31m──[39m [31m4. Failure: capture groups (@test-exec-all.R#71) [39m [31m──────────────────────────────[39m as.data.frame(res) not equal to asdf(...). Names: 1 string mismatch

[31m──[39m [31m5. Failure: scalar text with capure groups (@test-exec-all.R#92) [39m [31m──────────────[39m as.data.frame(res) not equal to asdf(...). Names: 1 string mismatch

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 65 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 5 ] 1. Failure: capture groups (@test-all.R#40) 2. Failure: scalar text with capure groups (@test-all.R#55) 3. Error: corner cases (@test-exec-all.R#46) 4. Failure: capture groups (@test-exec-all.R#71) 5. Failure: scalar text with capure groups (@test-exec-all.R#92)

Error: testthat unit tests failed Execution halted ```

RmarineHeatWaves

Version: 0.17.0
Source code: https://github.com/cran/RmarineHeatWaves
URL: https://github.com/ajsmit/RmarineHeatWaves
Date/Publication: 2018-06-04 17:43:40 UTC
Number of recursive dependencies: 61

Run revdep_details(,"RmarineHeatWaves") for more info

checking examples ... ERROR ``` ... > ts_dat <- make_whole(sst_WA) > res <- detect(ts_dat, climatology_start = "1983-01-01",
- climatology_end = "2012-12-31") Error: Can't cast to . Can not decrease dimensions [1m[22m Can't cast to . Can not decrease dimensions [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─RmarineHeatWaves::detect(...) [90m 2. [39m│ ├─base::[<-(...) [90m00_pkg_src/RmarineHeatWaves/R/RmarineHeatWaves.R:265:4[39m [90m 3. [39m│ └─tibble:::[<-.tbl_df(...) [90m00_pkg_src/RmarineHeatWaves/R/RmarineHeatWaves.R:265:4[39m [90m 4. [39m│ └─tibble:::tbl_subassign(x, i, j, value) [90m 5. [39m│ └─tibble:::tbl_subassign_row(xj, i, value) [90m 6. [39m│ └─vctrs::vec_slice<-(*tmp*, i, value = value[[j]]) [90m 7. [39m├─vctrs:::vec_cast_dispatch(x = x, to = to, x_arg = x_arg, to_arg = to_arg) [90m 8. [39m├─vctrs::vec_cast.double(x = x, to = to, x_arg = x_arg, to_arg = to_arg) [90m 9. [39m└─vctrs:::vec_cast.double.double(...) [90m 10. [39m └─vctrs:::shap Execution halted ```

rsample

Version: 0.0.5
Source code: https://github.com/cran/rsample
URL: https://tidymodels.github.io/rsample
BugReports: https://github.com/tidymodels/rsample/issues
Date/Publication: 2019-07-12 22:20:11 UTC
Number of recursive dependencies: 90

Run revdep_details(,"rsample") for more info

checking tests ... ``` ... > test_check(package = "rsample") [31m──[39m [31m1. Failure: Bootstrap estimate of mean is close to estimate of mean from normal [39m ttest$estimate not equal to single_pct_res$.estimate. names for target but not for current

[31m──[39m [31m2. Failure: Bootstrap estimate of mean is close to estimate of mean from normal [39m ttest$estimate not equal to single_t_res$.estimate. names for target but not for current

[31m──[39m [31m3. Failure: Bootstrap estimate of mean is close to estimate of mean from normal [39m ttest$estimate not equal to single_bca_res$.estimate. names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 529 | SKIPPED: 0 | WARNINGS: 13 | FAILED: 3 ] 1. Failure: Bootstrap estimate of mean is close to estimate of mean from normal distribution (@test_bootci.R#53) 2. Failure: Bootstrap estimate of mean is close to estimate of mean from normal distribution (@test_bootci.R#63) 3. Failure: Bootstrap estimate of mean is close to estimate of mean from normal distribution (@test_bootci.R#73)

Error: testthat unit tests failed Execution halted ```

RSDA

Version: 3.0
Source code: https://github.com/cran/RSDA
URL: http://www.oldemarrodriguez.com
Date/Publication: 2019-10-22 05:30:02 UTC
Number of recursive dependencies: 127

Run revdep_details(,"RSDA") for more info

checking examples ... ERROR ``` Running examples in ‘RSDA-Ex.R’ failed The error most likely occurred in:

Name: VeterinaryData

Title: Symbolic interval data example

Aliases: VeterinaryData

Keywords: datasets

** Examples

data(VeterinaryData) VeterinaryData Error in get(x, envir = ns, inherits = FALSE) : object 'check_names_df' not found Calls: ... head.data.frame -> [ -> [.symbolic_tbl -> getFromNamespace -> get Execution halted ```
checking tests ... ``` ... Attaching package: 'RSDA'

The following objects are masked from 'package:stats':
```
  cor, sd, var
```
test_check("RSDA") [31m──[39m [31m1. Failure: multiplication works (@test-read_sym_table.R#9) [39m [31m───────────────────[39m is.sym.modal(sym.table$F3) isn't true.

[31m──[39m [31m2. Failure: multiplication works (@test-read_sym_table.R#11) [39m [31m──────────────────[39m is.sym.set(sym.table$F5) isn't true.

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 24 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 2 ] 1. Failure: multiplication works (@test-read_sym_table.R#9) 2. Failure: multiplication works (@test-read_sym_table.R#11)

Error: testthat unit tests failed Execution halted ```

rubias

Version: 0.3.0
Source code: https://github.com/cran/rubias
Date/Publication: 2019-06-10 15:00:03 UTC
Number of recursive dependencies: 62

Run revdep_details(,"rubias") for more info

checking examples ... ERROR ... > > # note that in practice you will probably want to specify > # your own directory... > > # run the function > write_gsi_sim_mixture(chinook_mix, 5, prefix) Error: No common type for `value` <double> and `x` <character>. [1m<error/vctrs_error_incompatible_type>[22m No common type for `value` <double> and `x` <character>. [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─rubias::write_gsi_sim_mixture(chinook_mix, 5, prefix) [90m 2. [39m│ ├─base::`[<-`(`*tmp*`, is.na(mix), value = 0) [90m00_pkg_src/rubias/R/write_gsi_sim_mixture.R:36:2[39m [90m 3. [39m│ └─tibble:::`[<-.tbl_df`(`*tmp*`, is.na(mix), value = 0) [90m00_pkg_src/rubias/R/write_gsi_sim_mixture.R:36:2[39m [90m 4. [39m│ └─tibble:::tbl_subassign_matrix(x, j, value) [90m 5. [39m│ └─tibble:::map2(x[col_idx], cells[col_idx], `vec_slice<-`, value) [90m 6. [39m│ └─base::mapply(.f, .x, .y, MoreArgs = list(...), SIMPLIFY = FALSE) [90m 7. [39m│ └─(function (x, i, value) ... [90m 8. [39m├─vctrs:::vec_type2_dispatch(x = x, y = y, x_arg = x_arg, y_arg = y_arg) [90m 9. [39m├─vctrs::vec_ptype2. Execution halted

checking installed package size ... NOTE installed size is 10.4Mb sub-directories of 1Mb or more: libs 8.5Mb
checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements.

ruler

Version: 0.2.1
Source code: https://github.com/cran/ruler
URL: https://echasnovski.github.io/ruler/, https://github.com/echasnovski/ruler
BugReports: https://github.com/echasnovski/ruler/issues
Date/Publication: 2019-05-16 19:30:03 UTC
Number of recursive dependencies: 60

Run revdep_details(,"ruler") for more info

checking tests ... ``` ... [90m 8. [39mdplyr:::all.equal.tbl_df(...) [90m 9. [39mdplyr:::equal_data_frame(...)

[31m──[39m [31m2. Failure: new_pack_info removes names inside .packs (@test-exposure.R#118) [39m identical(output, input_packs_info) isn't true.

[31m──[39m [31m3. Error: is_exposure works (@test-exposure.R#166) [39m [31m────────────────────────────[39m x must be a vector, not a function [1mBacktrace:[22m [90m 1. [39mbase::[[<-(...) [90m 7. [39mvctrs:::stop_scalar_type(...) [90m 8. [39mvctrs:::stop_vctrs(msg, "vctrs_error_scalar_type", actual = x)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 299 | SKIPPED: 1 | WARNINGS: 2 | FAILED: 3 ] 1. Error: bind_exposures works (@test-expose-helpers.R#82) 2. Failure: new_pack_info removes names inside .packs (@test-exposure.R#118) 3. Error: is_exposure works (@test-exposure.R#166)

Error: testthat unit tests failed Execution halted ```

SanzCircos

Version: 0.1.0
Source code: https://github.com/cran/SanzCircos
Date/Publication: 2018-05-04 10:52:54 UTC
Number of recursive dependencies: 44

Run revdep_details(,"SanzCircos") for more info

checking examples ... ERROR ``` Running examples in ‘SanzCircos-Ex.R’ failed The error most likely occurred in:

Name: make_circos_links

Title: make_circos_links

Aliases: make_circos_links

** Examples

links_df <- data.frame(chrom = c(rep("chr1", 5), rep("chr2", 5)), + band = c(rep("band1", 3), rep("band2", 2), "band1", rep("band2", 4)), + link = c(1, 2, 3, 1, 2, 1, 1, 3, 4, 5), + start = c(1, 3, 5, 10, 35, 1, 5, 8, 13, 15), + end = c(3, 5, 10, 35, 39, 5, 8, 13, 15, 21))

links <- make_circos_links(links_df, "chrom", "band", "link", "start", "end", status = TRUE) Error: Lossy cast from value to x . ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘purrr’ ‘tidyr’ All declared Imports should be used.

sclr

Version: 0.3.0
Source code: https://github.com/cran/sclr
Date/Publication: 2019-11-26 21:40:02 UTC
Number of recursive dependencies: 57

Run revdep_details(,"sclr") for more info

checking tests ... ``` ... > test_check("sclr") [31m──[39m [31m1. Failure: protective titre is found correctly (@test-protection.R#12) [39m [31m───────[39m predict(fit, prot50_point)$prot_point not equal to 0.5. names for target but not for current

[31m──[39m [31m2. Failure: protective titre is found correctly (@test-protection.R#14) [39m [31m───────[39m predict(fit, prot50_low)$prot_l not equal to 0.5. names for target but not for current

[31m──[39m [31m3. Failure: protective titre is found correctly (@test-protection.R#16) [39m [31m───────[39m predict(fit, prot50_high)$prot_u not equal to 0.5. names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 84 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 3 ] 1. Failure: protective titre is found correctly (@test-protection.R#12) 2. Failure: protective titre is found correctly (@test-protection.R#14) 3. Failure: protective titre is found correctly (@test-protection.R#16)

Error: testthat unit tests failed Execution halted ```

silicate

Version: 0.2.0
Source code: https://github.com/cran/silicate
Date/Publication: 2019-10-09 11:30:02 UTC
Number of recursive dependencies: 138

Run revdep_details(,"silicate") for more info

checking examples ... ERROR ``` Running examples in ‘silicate-Ex.R’ failed The error most likely occurred in:

Name: TRI0

Title: TRI0 model, structural triangulations

Aliases: TRI0 TRI0.default TRI0.TRI TRI0.PATH0 TRI0.PATH

** Examples

tri <- TRI0(minimal_mesh) Error: Argument 5 must be length 12, not 2 Execution halted ```
checking tests ... ``` ... 1. testthat::expect_output(print(TRI0(minimal_mesh)))
1. silicate:::TRI0.default(minimal_mesh) revdep/checks/silicate/new/silicate.Rcheck/00_pkg_src/silicate/R/TRI0-model.R:17:2
2. silicate:::TRI0.PATH0(PATH0(x), ...) revdep/checks/silicate/new/silicate.Rcheck/00_pkg_src/silicate/R/TRI0-model.R:17:2
3. silicate:::triangulate_00(x) revdep/checks/silicate/new/silicate.Rcheck/00_pkg_src/silicate/R/TRI0-model.R:47:2
4. dplyr::bind_rows(trilist) revdep/checks/silicate/new/silicate.Rcheck/00_pkg_src/silicate/R/TRI0-model.R:97:2
5. dplyr:::bind_rows_(x, .id)
[31m──[39m [31m2. Error: building sf works (@test-spatial-build.R#6) [39m [31m─────────────────────────[39m x must be a vector, not a sfc_MULTIPOLYGON/sfc object [1mBacktrace:[22m [90m 1. [39mtestthat::expect_s3_class(build_sf(PATH(minimal_mesh)), "sf") [90m 12. [39mvctrs:::stop_scalar_type(...) [90m 13. [39mvctrs:::stop_vctrs(msg, "vctrs_error_scalar_type", actual = x)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 92 | SKIPPED: 7 | WARNINGS: 1 | FAILED: 2 ] 1. Error: print works (@test-print.R#11) 2. Error: building sf works (@test-spatial-build.R#6)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘geometry’ All declared Imports should be used.

simrel

Version: 2.0
Source code: https://github.com/cran/simrel
URL: https://simulatr.github.io/simrel/
BugReports: https://github.com/simulatr/simrel/issues
Date/Publication: 2019-04-01 18:00:09 UTC
Number of recursive dependencies: 98

Run revdep_details(,"simrel") for more info

checking tests ... ``` ... ERROR Running the tests in ‘tests/testthat.R’ failed. Complete output: > library(testthat) > library(simrel) > > test_check("simrel") [31m──[39m [31m1. Error: Prepare Design (@test-utils.R#44) [39m [31m───────────────────────────────────[39m Can't join on 'q' x 'q' because of incompatible types (list / list) [1mBacktrace:[22m [90m 1. [39mtestthat::expect_identical(prepare_design(opts), dgn) [90m 3. [39mtestthat:::compare.default(act$val, exp$val) [90m 5. [39mdplyr:::all.equal.tbl_df(x, y, ...) [90m 6. [39mdplyr:::equal_data_frame(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 169 | SKIPPED: 21 | WARNINGS: 3 | FAILED: 1 ] 1. Error: Prepare Design (@test-utils.R#44)

Error: testthat unit tests failed Execution halted ```

skimr

Version: 2.0.2
Source code: https://github.com/cran/skimr
URL: https://docs.ropensci.org/skimr (website), https://github.com/ropensci/skimr
BugReports: https://github.com/ropensci/skimr/issues
Date/Publication: 2019-11-26 14:30:03 UTC
Number of recursive dependencies: 71

Run revdep_details(,"skimr") for more info

checking tests ... ``` ...

[31m──[39m [31m6. Failure: You can use tidyselect negation (@test-skim.R#795) [39m [31m────────────────[39m input$skim_variable not identical to "feed". names for target but not for current

[31m──[39m [31m7. Failure: Tidyselect helpers work as expected (@test-skim.R#804) [39m [31m────────────[39m input$skim_variable not identical to c("Sepal.Length", "Sepal.Width"). names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 564 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 7 ] 1. Failure: skim returns expected response for numeric vectors (@test-skim.R#34) 2. Failure: skim returns expected response for factor vectors (@test-skim.R#178) 3. Failure: skim returns expected response for logical vectors (@test-skim.R#267) 4. Failure: skim returns expected response for complex vectors (@test-skim.R#319) 5. Failure: skim returns expected response for ts vectors (@test-skim.R#398) 6. Failure: You can use tidyselect negation (@test-skim.R#795) 7. Failure: Tidyselect helpers work as expected (@test-skim.R#804)

Error: testthat unit tests failed Execution halted ```

srvyr

Version: 0.3.6
Source code: https://github.com/cran/srvyr
URL: http://gdfe.co/srvyr, https://github.com/gergness/srvyr
BugReports: https://github.com/gergness/srvyr/issues
Date/Publication: 2019-10-05 21:00:02 UTC
Number of recursive dependencies: 90

Run revdep_details(,"srvyr") for more info

checking tests ... `` ... Incompatible type for columnsurvey_ratio_low: x numeric, y matrix Incompatible type for columnsurvey_ratio_upp`: x numeric, y matrix

[31m──[39m [31m2. Failure: deff and df work for grouped survey mean (@expect-equality.R#61) [39m [31m──[39m x not equal to y. Incompatible type for column survey_mean_low: x numeric, y matrix Incompatible type for column survey_mean_upp: x numeric, y matrix

[31m──[39m [31m3. Failure: deff and df work for grouped survey total (@expect-equality.R#61) [39m [31m─[39m x not equal to y. Incompatible type for column survey_total_low: x numeric, y matrix Incompatible type for column survey_total_upp: x numeric, y matrix

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 201 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 3 ] 1. Failure: deff and df work for grouped survey total (@expect-equality.R#61) 2. Failure: deff and df work for grouped survey mean (@expect-equality.R#61) 3. Failure: deff and df work for grouped survey total (@expect-equality.R#61)

Error: testthat unit tests failed Execution halted ```

stminsights

Version: 0.3.0
Source code: https://github.com/cran/stminsights
URL: https://github.com/cschwem2er/stminsights
BugReports: https://github.com/cschwem2er/stminsights/issues
Date/Publication: 2018-11-24 13:10:03 UTC
Number of recursive dependencies: 114

Run revdep_details(,"stminsights") for more info

checking examples ... ERROR ``` ...
- coord_flip() + theme_light() + labs(x = 'Treatment', y = 'Topic Proportion')
  
  combine estimates for interaction effects
  
  prep_int <- estimateEffect(1:3 ~ treatment * s(pid_rep),
- gadarianFit, gadarian)
  
  effects_int <- get_effects(estimates = prep_int,
- variable = 'pid_rep',
- type = 'continuous',
- moderator = 'treatment',
- modval = 1) %>%
- bind_rows(
- get_effects(estimates = prep_int,
- variable = 'pid_rep',
- type = 'continuous',
- moderator = 'treatment',
- modval = 0)
- ) Error: Argument 3 must be length 100, not 2 Execution halted ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘huge’ ‘readr’ ‘scales’ ‘shinyjs’ All declared Imports should be used.

taxa

Version: 0.3.2
Source code: https://github.com/cran/taxa
URL: https://github.com/ropensci/taxa
BugReports: https://github.com/ropensci/taxa/issues
Date/Publication: 2019-01-02 22:40:04 UTC
Number of recursive dependencies: 97

Run revdep_details(,"taxa") for more info

checking tests ... ``` ... > test_check("taxa") [31m──[39m [31m1. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#[39m test_obj$data$my_data$taxon_id not equal to c("j", "i"). names for target but not for current

[31m──[39m [31m2. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#[39m test_obj$data$my_data$taxon_id not equal to c("j", "i"). names for target but not for current

[31m──[39m [31m3. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#[39m test_obj$data$my_data$taxon_id not equal to c("j", "i"). names for target but not for current

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 607 | SKIPPED: 2 | WARNINGS: 1 | FAILED: 3 ] 1. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#52) 2. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#56) 3. Failure: Taxmap can be intialized from complex data (@test--taxmap_parsers.R#60)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespaces in Imports field not imported from: ‘knitr’ ‘lazyeval’ ‘rlang’ ‘tidyr’ All declared Imports should be used.

textrecipes

Version: 0.0.2
Source code: https://github.com/cran/textrecipes
URL: https://github.com/tidymodels/textrecipes
BugReports: https://github.com/tidymodels/textrecipes/issues
Date/Publication: 2019-09-07 11:20:02 UTC
Number of recursive dependencies: 97

Run revdep_details(,"textrecipes") for more info

checking examples ... ERROR ``` ... [3m[38;5;246m[39m[23m [38;5;250m1[39m [38;5;246m[39m [38;5;250m2[39m [38;5;246m[39m > > juice(okc_obj) %>%
- slice(2) %>%
- pull(essay0) [[1]] [1] "i'm" "chill" "and" "steadi" "br" "i'm" [7] "a" "teacher" "amp" "musician" "br" "i" [13] "like" "plai" "outsid" "dislik" "school" "night" [19] "br" "and" "i'm" "veri" "veri" "lucki"
tidy(okc_rec, number = 2) [38;5;246m# A tibble: 1 x 3[39m terms value id [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [3m[38;5;246m[39m[23m [38;5;250m1[39m essay0 [31mNA[39m stem_8wQnr tidy(okc_obj, number = 2) Error: All columns in a tibble must be vectors: ```
checking tests ... `` ... [90m 7. [39mtextrecipes:::tidy.step_untokenize(x$steps[[number]], ...) [90m 8. [39mtibble::tibble(terms = x$terms, value = x$sep) [90mrevdep/checks/textrecipes/new/textrecipes.Rcheck/00_pkg_src/textrecipes/R/untokenize.R:147:4[39m [90m 9. [39mtibble:::tibble_quos(xs[!is_null], .rows, .name_repair) [90m 10. [39mtibble:::check_valid_col(res, col_names[[j]], j) [90m 11. [39mtibble:::check_valid_cols(list2(:=`(!!name, x)))

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 79 | SKIPPED: 0 | WARNINGS: 4 | FAILED: 10 ] 1. Error: hashing gives double outputs (@test-hashing.R#31) 2. Error: stemming is done correctly (@test-stem.R#32) 3. Error: custom stemmer works (@test-stem.R#55) 4. Error: stopwords are removed correctly (@test-stopwords.R#33) 5. Error: step_tf works as intended (@test-tf.R#47) 6. Error: step_tfidf works as intended (@test-tfidf.R#50) 7. Error: tokenfilter removes words correctly using min_times and max_times (@test-tokenfilter.R#47) 8. Error: tokenization is done correctly (@test-tokenize.R#40) 9. Error: merging is done correctly (@test-tokenmerge.R#38) 10. Error: output is not a list (@test-untokenize.R#27)

Error: testthat unit tests failed Execution halted ```

checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘lifecycle’ All declared Imports should be used.

tidyr

Version: 1.0.0
Source code: https://github.com/cran/tidyr
URL: https://tidyr.tidyverse.org, https://github.com/tidyverse/tidyr
BugReports: https://github.com/tidyverse/tidyr/issues
Date/Publication: 2019-09-11 23:00:03 UTC
Number of recursive dependencies: 62

Run revdep_details(,"tidyr") for more info

checking tests ... ``` ... Attributes: < target is NULL, current is list >

[31m──[39m [31m11. Failure: values_summarize applied even when no-duplicates (@test-pivot-wide.[39m pv$x not equal to list_of(1L, 2L). Attributes: < target is NULL, current is list >

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 551 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 11 ] 1. Failure: optionally keep empty rows (@test-chop.R#57) 2. Failure: gather throws error for weird objects (@test-gather.R#141) 3. Failure: tibble conversion occurs in the nest.data.frame() method (@test-nest.R#71) 4. Failure: can nest multiple columns (@test-nest.R#80) 5. Failure: can nest multiple columns (@test-nest.R#81) 6. Failure: can control name_repair (@test-pack.R#68) 7. Failure: can pivot all cols to long (@test-pivot-long.R#8) 8. Failure: can drop missing values (@test-pivot-long.R#43) 9. Failure: duplicated keys produce list column with warning (@test-pivot-wide.R#73) 1. ...

Error: testthat unit tests failed Execution halted ```

checking data for non-ASCII characters ... NOTE Note: found 24 marked UTF-8 strings

units

Version: 0.6-5
Source code: https://github.com/cran/units
URL: https://github.com/r-quantities/units/
BugReports: https://github.com/r-quantities/units/issues/
Date/Publication: 2019-10-08 11:40:02 UTC
Number of recursive dependencies: 72

Run revdep_details(,"units") for more info

checking tests ... ``` ... ..$ numerator : chr "m" ..$ denominator: chr "s" ..- attr(*, "class")= chr "symbolic_units" Mixed units: mg (3), mm (3) 1e+06 [mm], 2e+06 [mm], 3e+06 [mm], 4000 [mg], 5000 [mg], 6000 [mg] [31m──[39m [31m1. Error: mixed units work (@test_mixed.R#46) [39m [31m─────────────────────────────────[39m All columns in a tibble must be vectors:
- Column m is mixed_units [1mBacktrace:[22m [90m 1. [39mbase::print(tibble::tibble(m)) [90m 2. [39mtibble::tibble(m) [90m 3. [39mtibble:::tibble_quos(xs[!is_null], .rows, .name_repair) [90m 4. [39mtibble:::check_valid_col(res, col_names[[j]], j) [90m 5. [39mtibble:::check_valid_cols(list2(:=(!!name, x)))
══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 416 | SKIPPED: 6 | WARNINGS: 13 | FAILED: 1 ] 1. Error: mixed units work (@test_mixed.R#46)

Error: testthat unit tests failed Execution halted ```

wtss

Version: 2.0.1
Source code: https://github.com/cran/wtss
URL: https://github.com/e-sensing/wtss/
BugReports: https://github.com/e-sensing/wtss/issues
Date/Publication: 2019-12-03 17:20:02 UTC
Number of recursive dependencies: 94

Run revdep_details(,"wtss") for more info

checking examples ... ERROR ``` ...
- longitude = -45.00, latitude = -12.00,
- start_date = "2000-02-18", end_date = "2016-12-18")
- plot(ts)
- } Connected to WTSS server at http://www.esensing.dpi.inpe.br/wtss/ Error: No common type for ..1$start_date and ..2$start_date . [1m[22m No common type for ..1$start_date and ..2$start_date . [1mBacktrace:[22m [90m [39m█ [90m 1. [39m├─wtss::time_series(...) [90m 2. [39m│ └─wtss:::.wtss_to_tibble(...) [90m00_pkg_src/wtss/R/wtss_time_series.R:129:4[39m [90m 3. [39m│ └─tibble::add_row(...) [90m00_pkg_src/wtss/R/wtss_tibble.R:73:4[39m [90m 4. [39m│ └─tibble:::rbind_at(.data, df, pos) [90m 5. [39m│ └─vctrs::vec_rbind(old, new) [90m 6. [39m├─vctrs:::vec_type2_dispatch(x = x, y = y, x_arg = x_arg, y_arg = y_arg) [90m 7. [39m├─vctrs:::vec_ptype2.tbl_df(x = x, y = y, x_arg = x_arg, y_arg = y_arg) [90m 8. [39m├─vctrs:::vec_ptype2.tbl_df.data.frame(...) [90m 9. [39m│ └─vctrs:::df_as_tibble(.Call(vctrs_type2_df_df, x, y, x_arg, y_arg)) [90m 10. [39m├─vctrs:::vec_type2_dispatch( Execution halted ```
checking tests ... ``` ... [90m 14. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 15. [39mvctrs:::stop_incompatible(...) [90m 16. [39mvctrs:::stop_vctrs(...)

[31m──[39m [31m2. Error: Time Series - conversion to ts and zoo (@test_wtss.R#90) [39m [31m────────────[39m No common type for ..1$start_date and ..2$start_date . [1mBacktrace:[22m [90m 1. [39mwtss::time_series(...) [90m 12. [39mvctrs:::vec_ptype2.Date.default(...) [90m 13. [39mvctrs::vec_default_ptype2(x, y, x_arg = x_arg, y_arg = y_arg) [90m 14. [39mvctrs::stop_incompatible_type(x, y, x_arg = x_arg, y_arg = y_arg) [90m 15. [39mvctrs:::stop_incompatible(...) [90m 16. [39mvctrs:::stop_vctrs(...)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 23 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 2 ] 1. Error: Time Series (@test_wtss.R#49) 2. Error: Time Series - conversion to ts and zoo (@test_wtss.R#90)

Error: testthat unit tests failed Execution halted ```

xpose

Version: 0.4.5
Source code: https://github.com/cran/xpose
URL: https://github.com/UUPharmacometrics/xpose
BugReports: https://github.com/UUPharmacometrics/xpose/issues
Date/Publication: 2019-10-07 04:50:03 UTC
Number of recursive dependencies: 102

Run revdep_details(,"xpose") for more info

checking examples ... ERROR ... > ### ** Examples > > # Histogram of parameters > prm_distrib(xpdb_ex_pk, type = 'h') Dropped fixed variables ALAG1. Using data from $prob no.1 Removing duplicated rows based on: ID Tidying data by ID, SEX, MED1, MED2, DOSE ... and 23 more variables > > # Density plot of etas with a rug > eta_distrib(xpdb_ex_pk, type = 'dr') Using data from $prob no.1 Removing duplicated rows based on: ID Tidying data by ID, SEX, MED1, MED2, DOSE ... and 23 more variables > > # Histogram of different residuals > res_distrib(xpdb_ex_pk, type = 'hr', res = c('IWRES', 'CWRES')) Using data from $prob no.1 Filtering data by EVID == 0 Error: `i` must have one dimension, not 2. Execution halted
checking tests ... `` ... [90m 4. [39mxpose::filter(data) [90mrevdep/checks/xpose/new/xpose.Rcheck/00_pkg_src/xpose/R/fetch_data.R:204:2[39m [90m 6. [39mtibble:::[.tbl_df`(x, x[, "EVID"] == 0, ) [90m 7. [39mtibble:::tbl_subset_row(xo, i = i) [90m 8. [39mtibble:::vec_as_row_index(i, x) [90m 9. [39mvctrs::vec_as_index(i, nr)

══ testthat results ══════════════════════════════════════════════════════════════ [ OK: 478 | SKIPPED: 6 | WARNINGS: 4 | FAILED: 29 ] 1. Error: only_obs function works properly (@test-fetch_data.R#15) 2. Error: fetch_data can get simple data (@test-fetch_data.R#30) 3. Error: fetch_data can tidy data (@test-fetch_data.R#43) 4. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function dv_vs_pred (@test-directory.R#186) 5. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function dv_vs_ipred (@test-directory.R#186) 6. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function dv_vs_idv (@test-directory.R#186) 7. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function ipred_vs_idv (@test-directory.R#186) 8. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function pred_vs_idv (@test-directory.R#186) 9. Error: xpose plot objects are returned with appropriate xpdb_ex_pk for plot_function dv_preds_vs_idv (@test-directory.R#186) 1. ...

Error: testthat unit tests failed Execution halted ```

krlmlr/tibble documentation built on Jan. 15, 2020, 7:56 a.m.

rdrr.io home R language documentation Run R code online

CRAN packages Bioconductor packages R-Forge packages GitHub packages

Note that we can't provide technical support on individual packages. You should contact the package authors for that.

krlmlr/tibble Simple Data Frames

revdep/problems.md In krlmlr/tibble: Simple Data Frames

amt

Newly broken

In both

basket

Newly broken

beadplexr

Newly broken

In both

bench

Newly broken

Name: autoplot.bench_mark

Title: Autoplot method for bench_mark objects

Aliases: autoplot.bench_mark plot.bench_mark

** Examples

breathtestcore

Newly broken

In both

comperank

Newly broken

concurve

Newly broken

Name: curve_corr

Title: Computes Consonance Intervals for Correlations

Aliases: curve_corr

** Examples

In both

corrr

Newly broken

cutpointr

Newly broken

cvms

Newly broken

diffdf

Newly broken

drake

Newly broken

egor

Newly broken

Name: clustered_graphs

Title: Cluster ego-centered networks by a grouping factor

Aliases: clustered_graphs clustered_graphs.list clustered_graphs.egor

clustered_graphs.data.frame

Keywords: analysis ego-centered network

** Examples

Simplify networks to clustered graphs, stored as igraph objects

eph

Newly broken

In both

evaluator

Newly broken

Name: exposure_histogram

Title: Display a histogram of losses for a scenario

Aliases: exposure_histogram

** Examples

exuber

Newly broken

In both

feasts

Newly broken

foieGras

Newly broken

In both

forestmangr

Newly broken

googlesheets4

Newly broken

haven

Newly broken

In both

healthcareai

Newly broken

heemod

Newly broken

Name: define_dsa

Title: Define a Sensitivity Analysis

Aliases: define_dsa define_dsa_

** Examples

In both

krlmlr/tibble
Simple Data Frames

revdep/problems.md
In krlmlr/tibble: Simple Data Frames

articles will be imported via `jst_get_article()` and `jst_get_authors()`