RACEseq: RACEseqR main function

In pantastheo/RACEseqR: Downstream analysis R package for 5-RACE Next Generation Sequencing experiments

Description

Function to generate the alignment from a RACE sequencing experiment

Usage

RACEseq(input_data, replicon_ref, filename, mismatch = 0, RACE_adapter,
  str = NULL, end = NULL, tmap = NULL, plot = NULL)

Arguments

input_data	The input .fastq files to be used for the alignment.
replicon_ref	The reference sequence to be used in the alignment.
filename	The filename that will be used for the output pdf file.
mismatch	The number of mismatches to be accepted during alignment. DEFAULT = 0
RACE_adapter	The RACE adapter to be trimmied using cutadapt.
str	The start position of the binding region.
end	The end position of the binding region.
tmap	The option to use the Tmap aligner instead of the default BOWTIE aligner. DEFAULT = FALSE
plot	The option to output the results in plot. The default output is an R dataframe object. DEFAULT = FALSE

Examples

RACEseq(filename = "foo", str = 9478, end = 9498, plot = T)
region_foo <- RACEseq(input_data = foo.fastq, replicon_ref = "foo.fasta", filename = "bar", RACE_adapter = "GGACACTGACATGGACTGAAGGAGTAGAAA", str = 9478, end = 9498)

pantastheo/RACEseqR documentation built on May 12, 2019, 6:16 p.m.