knitr::opts_chunk$set(
  collapse = TRUE,
  comment = "#>"
)

This documentation describes three use cases of this package.

  1. Compute the codon frequencies for a set of coding DNA sequences.
  2. Predict mRNA stability of a set of coding sequences using the model developed by Medina et al. 2020.
  3. Optimize mRNA stability with synonymous mutations.
library(iCodon)
library(dplyr)

1. Compute the codon frequencies for a set of coding DNA sequences

Suppose you have a table containing a set of coding DNA sequences like the one shown next.

set.seed(12)

codin_seqs <- training %>% 
  sample_n(100) %>% 
  select(gene_id, coding) %>% 
  filter(!duplicated(coding))
codin_seqs

If you wish to compute the codon-frequencies you can use the function add_codon_counts.

 add_codon_counts(codin_seqs)

see the help ?add_codon_counts for more information about this function.

2. Predict mRNA stability for a coding sequence

You can use the function predict_stability to predict the mRNA stability based on the codon sequence (Medina et al 2020).

Positive values indicate stability, while negative values indicate instability.

You need to specify a species. Possible species are:

predictor_human <- predict_stability(specie = "human")
# Now you can pass any coding sequence to this function
predictor_human("ATGTGGAGCGGCGGAGCTGAGCAACAACACCCTAAAACCGACAAATCTCACCGATGCAATGGCGTCGACAGCTCAAGAAGAAAGAACAGATCGCAGCGGTGGCGATATGAAGTCAAGAAAACTGGATGA")

If you have a table (see first example) you can add a column with the prediction for each sequence.

codin_seqs$prediction_optimality <- predictor_human(codin_seqs$coding)

select(codin_seqs, gene_id, prediction_optimality)

3. Optimize mRNA stability with synonymous mutations.

To optimize mRNA stability you can use the function optimizer.

a_seq <- "ATGTGGAGCGGCGGAGCTGAGCAACAACACCCTAAAACCGACAAATCTCACCGATGCAATGGCGTCGACAGCTCAAGAAGAAAGAACAGATCGCAGCGGTGGCGATATGAAGTCAAGAAAACTGGATGA"

optimizer(
  sequence_to_optimize = a_seq,
  specie = "human", n_iterations = 10,
  make_more_optimal = TRUE,
  mutation_Rate = .1,
  max_abs_val = 2,
  n_Daughters = 4
)

See the help ?optimizer for information about the parameters.



santiago1234/optimalcodonR documentation built on Oct. 31, 2023, 4:32 p.m.