tests/overrep_test.R
In winnie0521/qckit:
test_that("Test Overrepresented Sequence",{
#test whether the first row(largest counts) matches
expect_equal(as.vector(overrepresented_sequence("~/Desktop/Rdata/qckit/Data/10^5_reads_test.fq.gz")[1,])," 123 TGGGTGTGAGGAGTTCAGTTATATGTTTGGGATTTTTTAGGTAGTGGGTGTTGAGCTTGAACGCTTTCTTAATTGGTGGCTGCTTTTAGGCCTACTATGG")
})
winnie0521/qckit documentation built on May 14, 2019, 7:54 a.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
test_that("Test Overrepresented Sequence",{
#test whether the first row(largest counts) matches
expect_equal(as.vector(overrepresented_sequence("~/Desktop/Rdata/qckit/Data/10^5_reads_test.fq.gz")[1,])," 123 TGGGTGTGAGGAGTTCAGTTATATGTTTGGGATTTTTTAGGTAGTGGGTGTTGAGCTTGAACGCTTTCTTAATTGGTGGCTGCTTTTAGGCCTACTATGG")
})
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.