calcTm: Calculate Tm
In HELP: Tools for HELP data analysis

Description Usage Arguments Value Author(s) References See Also Examples

Calculate melting temperature (Tm) using the nearest-neighbor base-stacking algorithm and the unified thermodynamic parameters.

1	calcTm(x, ...)

x

characters containing nucleotide sequences (ex: "ATCGGAA") or an object of class ExpressionSet

...

Additional arguments passed to methods:

strand1.concentration: numeric value specifying concentration of strand 1 (default is 2e-07)
strand2.concentration: numeric value specifying concentration of strand 2 (default is 2e-07)
method: character value specifying the Tm algorithm to use (default is "nearest-neighbor"); currently not supported

Returns a numerical value indicating the predicted melting temperature (Tm) of the sequence in degrees Celsius. A value of NA is returned if the function encounters an error that prevents proper Tm calculation.

Reid F. Thompson (rthompso@aecom.yu.edu)

Allawi, H.T. and SantaLucia, J., Jr. (1997) Thermodynamics and NMR of internal G.T mismatches in DNA, Biochemistry, 36, 10581-10594.

calcTm-methods, base.stacking.thermodynamics, calcGC

#demo(pipeline,package="HELP")

calcTm("GTGTGGCTACAGGTGGGCCGTGGCGCACCTAAGTGAGGACAGAGAACAAC")
calcTm("GTGTGGCTACAGGTGGGCCGTGGCGCACCTAAGTGAGGACAGAGAACAAC",strand1.concentration=1E-5,strand2.concentration=2E-8)