extrDNAPseKNC: The Pseudo K-tupler Composition Descriptor

In BioMedR: Generating Various Molecular Representations for Chemicals, Proteins, DNAs, RNAs and Their Interactions

Description

The Pseudo K-tupler Composition Descriptor

Usage

extrDNAPseKNC(x, lambda = 1, k = 3, normalize = FALSE, w = 0.5,
  customprops = NULL)

Arguments

x	the input data, which should be a list or file type.
lambda	an integer larger than or equal to 0 and less than or equal to L-2 (L means the length of the shortest sequence in the dataset). It represents the highest counted rank (or tier) of the correlation along a DNA sequence. Its default value is 3.
k	an integer larger than 0 represents the k-tuple. Its default value is 3.
normalize	with this option, the final feature vector will be normalized based on the total occurrences of all kmers. Therefore, the elements in the feature vectors represent the frequencies of kmers. The default value of this parameter is False.
w	the weight factor ranged from 0 to 1. Its default value is 0.05.
customprops	the users can use their own indices to generate the feature vector. It should be a dict, the key is dinucleotide (string), and its corresponding value is a list type.

Details

This function calculates the pseudo k-tupler composition Descriptor

Value

A vector

Note

if the user defined physicochemical indices have not been normalized, it should be normalized.

Author(s)

Min-feng Zhu <[e-mail]>

References

Guo S H, Deng E Z, Xu L Q, et al. iNuc-PseKNC: a sequence-based predictor for predicting nucleosome positioning in genomes with pseudo k-tuple nucleotide composition. Bioinformatics, 2014: btu083.

See Also

See extrDNAPseDNC

Examples

 
x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrDNAPseKNC(x)

BioMedR documentation built on July 5, 2019, 9:03 a.m.