Tm_GC: Calculate the melting temperature using empirical formulas...

In TmCalculator: Melting Temperature of Nucleic Acid Sequences

Calculate the melting temperature using empirical formulas based on GC content

Description

Calculate the melting temperature using empirical formulas based on GC content with different options

Usage

Tm_GC(
  ntseq,
  ambiguous = FALSE,
  userset = NULL,
  variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
    "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
  Na = 0,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0,
  saltcorr = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
    "Owczarzy2004", "Owczarzy2008"),
  mismatch = TRUE,
  DMSO = 0,
  fmd = 0,
  DMSOfactor = 0.75,
  fmdfactor = 0.65,
  fmdmethod = c("concentration", "molar"),
  outlist = TRUE
)

Arguments

ntseq	Sequence (5' to 3') of one strand of the nucleic acid duplex as string or vector of characters.
ambiguous	Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE.
userset	A vector of four coefficient values. Usersets override value sets.
variant	Empirical constants coefficient with 8 variant: Chester1993, QuikChange, Schildkraut1965, Wetmur1991_MELTING, Wetmur1991_RNA, Wetmur1991_RNA/DNA, Primer3Plus and vonAhsen2001
Na	Millimolar concentration of Na, default is 0
K	Millimolar concentration of K, default is 0
Tris	Millimolar concentration of Tris, default is 0
Mg	Millimolar concentration of Mg, default is 0
dNTPs	Millimolar concentration of dNTPs, default is 0
saltcorr	Salt correction method should be chosen when provide 'userset'. Options are "Schildkraut2010", "Wetmur1991","SantaLucia1996","SantaLucia1998-1","Owczarzy2004","Owczarzy2008". Note that "SantaLucia1998-2" is not available for this function.
mismatch	If 'True' (default) every 'X' in the sequence is counted as mismatch
DMSO	Percent DMSO
fmd	Formamide concentration in percentage (fmdmethod="concentration") or molar (fmdmethod="molar").
DMSOfactor	Coeffecient of Tm decreases per percent DMSO. Default=0.75 von Ahsen N (2001) <PMID:11673362>. Other published values are 0.5, 0.6 and 0.675.
fmdfactor	Coeffecient of Tm decrease per percent formamide. Default=0.65. Several papers report factors between 0.6 and 0.72.
fmdmethod	"concentration" method for formamide concentration in percentage and "molar" for formamide concentration in molar
outlist	output a list of Tm and options or only Tm value, default is TRUE.

Details

Empirical constants coefficient with 8 variant:

Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N

QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch

Schildkraut1965: Tm = 81.5 + 0.41(Percentage_GC) - 675/N + 16.6 x log[Na+]

Wetmur1991_MELTING: Tm = 81.5 + 0.41(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch

Wetmur1991_RNA: Tm = 78 + 0.7(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch

Wetmur1991_RNA/DNA: Tm = 67 + 0.8(Percentage_GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+])) - Percentage_mismatch

Primer3Plus: Tm = 81.5 + 0.41(Percentage_GC) - 600/N + 16.6 x log[Na+]

vonAhsen2001: Tm = 77.1 + 0.41(Percentage_GC) - 528/N + 11.7 x log[Na+]

Author(s)

Junhui Li

References

Marmur J , Doty P . Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature.[J]. Journal of Molecular Biology, 1962, 5(1):109-118.

Schildkraut C . Dependence of the melting temperature of DNA on salt concentration[J]. Biopolymers, 2010, 3(2):195-208.

Wetmur J G . DNA Probes: Applications of the Principles of Nucleic Acid Hybridization[J]. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.

Untergasser A , Cutcutache I , Koressaar T , et al. Primer3–new capabilities and interfaces[J]. Nucleic Acids Research, 2012, 40(15):e115-e115.

von Ahsen N, Wittwer CT, Schutz E , et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.

Examples

ntseq <- c("ATCGTGCGTAGCAGTACGATCAGTAG")
out <- Tm_GC(ntseq,ambiguous=TRUE,variant="Primer3Plus",Na=50,mismatch=TRUE)
out
out$Tm
out$Options

TmCalculator documentation built on March 18, 2022, 6:10 p.m.