Nothing
#' Generate Reverse Complement of DNA sequence
#'
#' Given a DNA sequence, the function generates the reverse complement of the sequence and returns it.
#'
#' @param sequence A character string containing the DNA sequence to be reversed and complemented
#' @return A character string containing the reverse complement of the input DNA sequence
#' @examples
#' sequence <- "ATCGAGCTAGCTAGCTAGCTAGCT"
#' reverse_complement(sequence)
#' # [1] "AGCTAGCTAGCTAGCTAGCTCGAT"
#' @export
reverse_complement <- function(sequence) {
# Convert the sequence to upper case to make it case-insensitive
sequence <- toupper(sequence)
# Create a named vector of base complements
complements <- c(A="T", C="G", G="C", T="A")
# Reverse the sequence and replace each base with its complement
complement_sequence <- sapply(strsplit(sequence, "")[[1]], function(base) complements[[base]])
reverse_complement_sequence <- paste(rev(complement_sequence), collapse="")
# Return the reverse complement sequence
return(reverse_complement_sequence)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.