add_adapters | R Documentation |
Add set of adapters to oligonucleotide probes
add_adapters( probe.id.var, probe.var, ad.len, ad.nucl = "t", end = c(3, 5), mc.cores = 1, digits = 4, return = "dataframe", data, data.probe.id.var, count.mfe = FALSE, RNAfold.path, temperature = 40, trim.mfe = FALSE, MFEmin = 0, MFE.files.dir = NULL, delete.MFE.files = FALSE, verbose = TRUE )
probe.id.var |
vector of probes' identification numbers |
probe.var |
character; character; vector of nucleotide probes |
ad.len |
integer; vector of adapter length |
ad.nucl |
character; vector of adapter nucleotides |
end |
integer; probe's end for adapter attachment. Possible values are 3 and 5. |
mc.cores |
integer; number of processors for parallel computation (not supported on Windows) |
digits |
integer; number of decimal places to round the result (MFE) |
return |
character; returned object; possible values are: |
data, data.probe.id.var |
user's data frame and it's variable with probes identification numbers (used if |
count.mfe |
logical; count minimum folding energy for probes with adapters |
RNAfold.path, temperature, trim.mfe, MFEmin, MFE.files.dir, delete.MFE.files |
used if |
verbose |
logical; show messages |
ad.len
parameter indicates number of ad.nucl
repeats.
For example, with ad.len =5
for ad.nucl = "t"
adapter will be "ttttt"
and for
ad.nucl = "ac"
adapter will be "acacacacac"
.
ad.len
, ad.nucl
and end
might be vectors of any length.
All possible variants of adapters will be added to probes and tested.
For MFE counting ViennaRNA Package (UNIX or Windows) must be installed. see count_MFE[disprose] for details
Vector of nucleotide probes with added adapters, or data frame with probes, adapters and their characteristics, or user's data frame with added data of probes, adapters and their characteristics.
Elena N. Filatova
probes <- data.frame (ids = 1:3, probes = c ("acacacacacaca", "aaaaagggggtttttccccc", "atgcgctagctcagc")) ad.data <- add_adapters(probe.var = probes$probes, probe.id.var = probes$ids, ad.len = c(5, 8), ad.nucl = c("t", "dt"), end = c(3, 5), count.mfe = FALSE, mc.cores = 1, digits = 4, return = "dataframe", data = probes, data.probe.id.var = probes$ids)
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.