add_adapters: Add adapters to probes

Description Usage Arguments Details Value Author(s) Examples

Description

Add set of adapters to oligonucleotide probes

Usage

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
add_adapters(
  probe.id.var,
  probe.var,
  ad.len,
  ad.nucl = "t",
  end = c(3, 5),
  mc.cores = 1,
  digits = 4,
  return = "dataframe",
  data,
  data.probe.id.var,
  count.mfe = FALSE,
  RNAfold.path,
  temperature = 40,
  trim.mfe = FALSE,
  MFEmin = 0,
  MFE.files.dir = NULL,
  delete.MFE.files = FALSE,
  verbose = TRUE
)

Arguments

probe.id.var

vector of probes' identification numbers

probe.var

character; character; vector of nucleotide probes

ad.len

integer; vector of adapter length

ad.nucl

character; vector of adapter nucleotides

end

integer; probe's end for adapter attachment. Possible values are 3 and 5.

mc.cores

integer; number of processors for parallel computation (not supported on Windows)

digits

integer; number of decimal places to round the result (MFE)

return

character; returned object; possible values are: "vector" (vector of nucleotide probes with added adapters), "dataframe" (data frame with probes, adapters and their characteristics), "add" (user's data frame with added data of probes, adapters and their characteristics)

data, data.probe.id.var

user's data frame and it's variable with probes identification numbers (used if return = "add")

count.mfe

logical; count minimum folding energy for probes with adapters

RNAfold.path, temperature, trim.mfe, MFEmin, MFE.files.dir, delete.MFE.files

used if count.mfe = TRUE; see count_MFE[disprose] for details

verbose

logical; show messages

Details

ad.len parameter indicates number of ad.nucl repeats. For example, with ad.len =5 for ad.nucl = "t" adapter will be "ttttt" and for ad.nucl = "ac" adapter will be "acacacacac".

ad.len, ad.nucl and end might be vectors of any length. All possible variants of adapters will be added to probes and tested.

For MFE counting ViennaRNA Package (UNIX or Windows) must be installed. see count_MFE[disprose] for details

Value

Vector of nucleotide probes with added adapters, or data frame with probes, adapters and their characteristics, or user's data frame with added data of probes, adapters and their characteristics.

Author(s)

Elena N. Filatova

Examples

1
2
3
4
5
6
probes <- data.frame (ids = 1:3,  probes = c ("acacacacacaca", "aaaaagggggtttttccccc",
                                             "atgcgctagctcagc"))
ad.data <- add_adapters(probe.var = probes$probes, probe.id.var = probes$ids,
                       ad.len = c(5, 8), ad.nucl = c("t", "dt"), end = c(3, 5),
                       count.mfe = FALSE, mc.cores = 1, digits = 4,
                       return = "dataframe", data = probes, data.probe.id.var = probes$ids)

disprose documentation built on Jan. 6, 2022, 1:07 a.m.