blast_local: Local BLAST

In disprose: Discriminating Probes Selection

Local BLAST

Description

Perform nucleotide BLAST with local database

Usage

blast_local(
  probe.var,
  probe.id.var = NULL,
  fasta.way = NULL,
  blastn.way = NULL,
  db.way = NULL,
  out.way = NULL,
  mc.cores = 1,
  add.query.info = FALSE,
  temp.db = NULL,
  delete.files = FALSE,
  eval = 1000,
  ws = 7,
  reward = 1,
  penalty = -3,
  gapopen = 5,
  gapextend = 2,
  maxtargetseqs = 500,
  verbose = TRUE
)

Arguments

probe.var	character; query - vector of nucleotide sequences
probe.id.var	vector of identification numbers for query sequences
fasta.way	character; name and path to FASTA file
blastn.way	character; name and path to blastn executable file
db.way	character; name and path to local BLAST database
out.way	character; name and path to blastn output file
mc.cores	integer; number of processors for parallel computation (not supported on Windows)
add.query.info	logical; add query nucleotide sequence and its length to result
temp.db	character; temporal SQLite database name and path
delete.files	logical; delete created FASTA and output files
eval	integer; expect value for saving hits
ws	integer; length of initial exact match
reward	integer; reward for a nucleotide match
penalty	integer; penalty for a nucleotide mismatch
gapopen	integer; cost to open a gap
gapextend	integer; cost to extend a gap
maxtargetseqs	integer; number of aligned sequences to keep
verbose	logical; show messages

Details

For this function BLAST+ executables (blastn) must be installed and local nucleotide database must be created.

While working, the function creates blastn input FASTA file and output file. If files exist already, they will be overwritten. Those files could be deleted by delete.files = TRUE parameter.

If no probe.id.var is provided, query sequences are numbered in order, starting with 1.

Query cover is query coverage per HSP (as a percentage)

If add.query.info = TRUE function saves data in temporal SQLite database. Function will stop if same database already exists, so deleting temporal database (by setting delete.files = TRUE) is highly recommended.

"no lines available in input" error is returned when there are no BLAST results matching the specified parameters. Adjust BLAST parameters.

Value

Data frame with BLAST alignments: query sequence id, start and end of alignment in query, subject GI, accession, title and taxon id, start and end of alignment in subject, length of alignment, number of mismatches and gaps, number of identical matches, raw score, bit score, expect value and query cover. If add.result.info = TRUE, query sequence and its length are also added to data frame.

Author(s)

Elena N. Filatova

References

Camacho C., Coulouris G., Avagyan V. et al. (2009). BLAST+: architecture and applications. BMC Bioinformatics 10, 421. https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-10-421.

Examples

## Not run: 
# This function is using BLAST applications. BLAST+ should be installed.
# Local nucleotide database should be created
# Local database of target sequences of Chlamydia pneumoniae was created
# in temporal directory previously (see make_blast_DB () function)
path <- tempdir()
dir.create (path)
#set probes for local BLAST
probes <- c ("catctctatttcggtagcagctcc", "aaagtcatagaaaagcctgtagtcgc",
            "ccttcttctcgaactctgaagtacact", "aaaaaaaaaaaaaaaaa", "acacacacacacaac")
blast.raw <- blast_local(probe.var = probes, probe.id.var = NULL,
                        fasta.way = paste0 (path, "/blast.fasta"),
                        blastn.way = "D:/Blast/blast-2.11.0+/bin/blastn.exe",
                        db.way = paste0 (path, "/DB"),
                        out.way = paste0 (path, "/blast.out"),
                        mc.cores=1, add.query.info = TRUE, temp.db = paste0 (path, "/temp.db"),
                        delete.files = TRUE, eval = 1, maxtargetseqs = 200)

## End(Not run)

disprose documentation built on March 19, 2022, 2:15 a.m.