aphased: Predicting A-phased DNA repeat(s)

In gquad: Prediction of G Quadruplexes and Other Non-B DNA Motifs

Predicting A-phased DNA repeat(s)

Description

This function predicts A-phased DNA repeat(s) in 'x' (DNA). DNA sequence can be provided in raw or fasta format or as GenBank accession number(s). Internet is needed to connect to GenBank database, if accession number(s) is given as argument.

Usage

aphased(x, xformat = "default")

Arguments

x	DNA sequence(s) in raw format or a fasta file or a GenBank accession number(s); from which A-phased DNA repeat(s) will be predicted. If the fasta file name does not contain an absolute path, the file name is relative to the current working directory.
xformat	a character string specifying the format of x : default (raw), fasta, GenBank (GenBank accession number(s)).

Details

This function predicts A-phased DNA repeat(s) in DNA sequences and provide the position, sequence and length of the predicted repeat(s), if any.

Value

A dataframe of A-phased DNA repeats' position, sequence and length. If more than one DNA sequence is provided as argument, an input ID is returned for repeat(s) predicted from each input sequence.

Author(s)

Hannah O. Ajoge

References

Paper on gquad and the web application (Non-B DNA Predictor) is under review, see draft in vignettes

Examples

 ## Predicting A-phased DNA repeat(s) from raw DNA sequences
E1 <- "TCTTGTTTTAAAACGTTTTAAAACGTTTTAAAACGTTTTAAAACGAAT"
aphased(E1)

## Predicting A-phased DNA repeat(s) from DNA sequences in fasta file
## Not run: aphased(x="Example.fasta", xformat = "fasta")

## Predicting A-phased DNA repeat(s) from DNA sequences,
## using GenBank accession numbers.
## Internet connectivity is needed for this to work.
## Not run: aphased(c("BH114913", "AY611035"), xformat = "GenBank")

gquad documentation built on Nov. 29, 2022, 9:05 a.m.