hdna: Predicting intramolecular triplexes (H-DNA)

Description Usage Arguments Details Value Author(s) References See Also Examples

View source: R/hdna.R

Description

This function predicts H-DNA in 'x' (DNA). DNA can be provided in raw or fasta format or as GenBank accession number(s). Internet is needed to connect to GenBank database, if accession number(s) is given as argument.

Usage

1
hdna(x, xformat = "default")

Arguments

x

DNA sequence(s) in raw format or a fasta file or a GenBank accession number(s); from which H-DNA will be predicted. If the fasta file name does not contain an absolute path, the file name is relative to the current working directory.

xformat

a character string specifying the format of x : default (raw), fasta, GenBank (GenBank accession number(s)).

Details

This function predicts H-DNA in DNA sequences and provide the position, sequence and length of the predicted motif(s), if any.

Value

A dataframe of H-DNA' position, sequence and length. If more than one DNA sequence is provided as argument, an input ID is returned for motif(s) predicted from each input sequence.

Author(s)

Hannah O. Ajoge

References

paper under review

See Also

hdnaO

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
## Predicting H-DNA from raw DNA sequences
E1 <- c("TCTTCCCCCCTTTTTYYYYYGCTYYYYYTTTTTCCCCCCGAAT", "taggtgctgggaggtagagacaggatatcct")
hdna(E1)

## Predicting H-DNA from DNA sequences in fasta file
## Not run: hdna(x="Example.fasta", xformat = "fasta")

## Predicting H-DNA from DNA sequences,
## using GenBank accession numbers.
## Internet connectivity is needed for this to work.
## Not run: hdna(c("BH114913", "AY611035"), xformat = "GenBank")

Example output

Attaching package: 'gquad'

The following object is masked from 'package:utils':

    str

  input_ID sequence_position                            sequence
1        1                 5 CCCCCCTTTTTYYYYYGCTYYYYYTTTTTCCCCCC
2        2                 -                                   -
  sequence_length
1              35
2               -

gquad documentation built on May 2, 2019, 12:19 p.m.

Related to hdna in gquad...