extrPseKNC: The Pseudo K-tupler Composition Descriptor

In rDNAse: Generating Various Numerical Representation Schemes of DNA Sequences

Description

The Pseudo K-tupler Composition Descriptor

Usage

extrPseKNC(x, lambda = 1, k = 3, normalize = FALSE, w = 0.5,
  customprops = NULL)

Arguments

x	the input data, which should be a list or file type.
lambda	an integer larger than or equal to 0 and less than or equal to L-2 (L means the length of the shortest sequence in the dataset). It represents the highest counted rank (or tier) of the correlation along a DNA sequence. Its default value is 3.
k	an integer larger than 0 represents the k-tuple. Its default value is 3.
normalize	with this option, the final feature vector will be normalized based on the total occurrences of all kmers. Therefore, the elements in the feature vectors represent the frequencies of kmers. The default value of this parameter is False.
w	the weight factor ranged from 0 to 1. Its default value is 0.05.
customprops	the users can use their own indices to generate the feature vector. It should be a dict, the key is dinucleotide (string), and its corresponding value is a list type.

Details

This function calculates the pseudo k-tupler composition Descriptor

Value

A vector

Note

if the user defined physicochemical indices have not been normalized, it should be normalized.

Author(s)

Min-feng Zhu <[e-mail]>

References

Guo S H, Deng E Z, Xu L Q, et al. iNuc-PseKNC: a sequence-based predictor for predicting nucleosome positioning in genomes with pseudo k-tuple nucleotide composition. Bioinformatics, 2014: btu083.

See Also

See extrPseDNC

Examples

x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrPseKNC(x)

Example output

     Xc1.AAA      Xc1.AAC      Xc1.AAG      Xc1.AAT      Xc1.ACA      Xc1.ACC 
       0.000        0.014        0.000        0.000        0.000        0.000 
     Xc1.ACG      Xc1.ACT      Xc1.AGA      Xc1.AGC      Xc1.AGG      Xc1.AGT 
       0.000        0.041        0.000        0.000        0.000        0.000 
     Xc1.ATA      Xc1.ATC      Xc1.ATG      Xc1.ATT      Xc1.CAA      Xc1.CAC 
       0.014        0.000        0.000        0.027        0.000        0.014 
     Xc1.CAG      Xc1.CAT      Xc1.CCA      Xc1.CCC      Xc1.CCG      Xc1.CCT 
       0.000        0.014        0.000        0.000        0.000        0.000 
     Xc1.CGA      Xc1.CGC      Xc1.CGG      Xc1.CGT      Xc1.CTA      Xc1.CTC 
       0.000        0.000        0.000        0.000        0.000        0.014 
     Xc1.CTG      Xc1.CTT      Xc1.GAA      Xc1.GAC      Xc1.GAG      Xc1.GAT 
       0.027        0.014        0.014        0.014        0.000        0.000 
     Xc1.GCA      Xc1.GCC      Xc1.GCG      Xc1.GCT      Xc1.GGA      Xc1.GGC 
       0.014        0.000        0.000        0.014        0.000        0.000 
     Xc1.GGG      Xc1.GGT      Xc1.GTA      Xc1.GTC      Xc1.GTG      Xc1.GTT 
       0.000        0.014        0.000        0.000        0.000        0.014 
     Xc1.TAA      Xc1.TAC      Xc1.TAG      Xc1.TAT      Xc1.TCA      Xc1.TCC 
       0.000        0.000        0.000        0.027        0.014        0.000 
     Xc1.TCG      Xc1.TCT      Xc1.TGA      Xc1.TGC      Xc1.TGG      Xc1.TGT 
       0.000        0.000        0.014        0.027        0.014        0.000 
     Xc1.TTA      Xc1.TTC      Xc1.TTG      Xc1.TTT Xc2.lambda.1 
       0.014        0.014        0.027        0.041        0.550 

rDNAse documentation built on May 2, 2019, 4:16 a.m.