gb2fasta: Conversion of GenBank file into fasta file

View source: R/gb2fasta.R

gb2fastaR Documentation

Conversion of GenBank file into fasta file

Description

Converts a single entry in GenBank format into a fasta file.

Usage

gb2fasta(source.file, destination.file)

Arguments

source.file

GenBank file

destination.file

Fasta file

Details

Multiple entries in GenBank file are not supported.

Value

none

Author(s)

J.R. Lobry

References

citation("seqinr")

See Also

oriloc

Examples

  myGenBankFile <- system.file("sequences/ct.gbk.gz", package = "seqinr")
  #myFastaFileName <- "Acinetobacter_ADP1_uid61597.fasta"
  myFastaFileName <-tempfile(pattern = "Acinetobacter_ADP1_uid61597", 
   tmpdir = tempdir(), fileext = "fasta")
  tempdir(check = FALSE)
  gb2fasta(myGenBankFile, myFastaFileName)
  readLines(myFastaFileName)[1:5]
  #
  # Should be :
  #
  # [1] ">CHLTCG 1042519 bp"                                          
  # [2] "gcggccgcccgggaaattgctaaaagatgggagcaaagagttagagatctacaagataaa"
  # [3] "ggtgctgcacgaaaattattaaatgatcctttaggccgacgaacacctaattatcagagc"
  # [4] "aaaaatccaggtgagtatactgtagggaattccatgttttacgatggtcctcaggtagcg"
  # [5] "aatctccagaacgtcgacactggtttttggctggacatgagcaatctctcagacgttgta"
  #

seqinr documentation built on May 20, 2022, 1:09 a.m.