View source: R/genie_functions.R
grep_analysis | R Documentation |
For each replicate associated with an input region, grep_analysis
searches for alleles matching the HDR or WT sequences, and returns statistics
that indicate whether the HDR:WT ratio differs in cDNA (or ATAC) and gDNA.
grep_analysis(
regions,
replicates,
required_match_left = 10,
required_match_right = 10,
min_mapq = 0,
quiet = FALSE
)
regions |
A data.frame defining GenIE regions. |
replicates |
A data.frame defining GenIE replicates. |
required_match_left |
The length of sequence to the left of the HDR site that must exactly match to identify HDR or WT reads. |
required_match_right |
The length of sequence to the right of the HDR site that must exactly match to identify HDR or WT reads. |
min_mapq |
The minimum mapping quality for reads to be included in the analysis. |
quiet |
If TRUE, then no messages are printing during the analysis. |
For a grep analysis, the regions parameter is a data.frame with a format as follows. All of the column names below must be specified.
name | sequence_name | start | end | highlight_site | cut_site | hdr_allele_profile | wt_allele_profile | ref_sequence |
MUL1_rs6700034 | MUL1 | 1 | 21 | 11 | 9 | ----------A---------- | ----------C---------- | ACCGCACCCCCCCGGCCTAAC |
name | A unique identifier for the region. |
sequence_name | The chromosome or amplicon sequence name. |
start | The start coordinate of the amplicon relative to the chromosome or amplicon reference. |
end | The end coordinate of the amplicon relative to the chromosome or amplicon reference (the end coordinate is included in the region). |
highlight_site | The relative position of the site of interest, usually the HDR SNP site. |
cut_site | The relative position of the cut site. |
ref_sequence | The reference sequence for the amplicon region, which must have length (end - start + 1). |
hdr_allele_profile | An allele profile describing the HDR allele. See details below. |
wt_allele_profile | An allele profile describing the WT allele. See details below. |
If multiple rows are defined for 'regions', then a separate analysis is run for each region, using matched replicates from 'replicates'.
The allele_profile columns indicate the positions in the amplicon sequence that must match a given nucleotide for a read to be considered either HDR or WT. This sequence must be the same length as the reference sequence, and all other positions should be "-". The total sequence region that must match is determined by both the positions of specified nucleotides and by the required_match_left and required_match_right parameters. These parameters give the length of sequence which must match the provided reference sequence to the left of the leftmost specified nucleotide, or to the right of the rightmost specified nucleotide.
The replicates parameter is a data.frame with a format as below.
name | replicate | type | bam |
MUL1_rs6700034 | c1.2 | cDNA | bam_amplicon/MUL1_rs6700034_cDNA_rep1_pcr2.sortedByCoord.bam |
MUL1_rs6700034 | c1.3 | cDNA | bam_amplicon/MUL1_rs6700034_cDNA_rep1_pcr3.sortedByCoord.bam |
name | Indicates the region that a given replicate corresponds with. All replicates matching the name in the regions table will be used. |
replicate | an ID for the replicate, which must be unique among replicates for the region. |
type | Must have the value "cDNA", "ATAC", or "gDNA", indicating whether a given replicate contains data for cDNA, ATAC, or gDNA. |
bam | the path (relative to the working directory) to a BAM file with sequencing reads for the replicate. |
Either cDNA or ATAC replicates should be given, but not both for a single region.
Statistics can only be computed if there are at least 2 replicates of each type (cDNA and gDNA). Replicates are matched to the region based on the name column.
The returned object is a list, where each item is the result for one region. The result for a region (e.g. results[[1]]) is itself a list, with the following items:
region_stats | Main analysis output, with statistics indicating whether the HDR/WT levels differ in cDNA relative to gDNA. |
replicate_stats | A data.frame with a row for each replicate, which has counts of reads in different categories and some summary values. |
region | Details of the input region the result corresponds to. |
replicates | Details of the input replicates the result corresponds to. |
opts | A list containing the options that were given for the analysis. |
type | Has the value “grep_analysis”, and is used by plotting functions that take a full grep_result list as input. |
The main output of interest is the 'region_stats' field, which is a one-row data.frame with the following values:
name | Name of the region. |
effect | Estimated effect size - the amount by which the HDR:WT ratio differs in cDNA relative to gDNA. |
effect_sd | Standard deviation of the estimated effect size. |
effect_confint_lo | Lower bound of the 95% confidence interval for the effect size. |
effect_confint_hi | Upper bound of the 95% confidence interval for the effect size. |
df_estimated | The degrees of freedom used in the unequal variances t-test, which is estimated from the data. |
pval | A p value from the unequal variants t-test. |
alignment_analysis
grep_summary_plot
# Note: to run an analysis you need BAM files from a GenIE experiment.
# An example is available for download using download_example().
dl_dir = tempdir()
download_example(dir = dl_dir, name = "MUL1")
# Data are downloaded and we can run an rgenie analysis
setwd(dl_dir)
regions = readr::read_tsv("mul1.genie_regions.tsv")
replicates = readr::read_tsv("mul1.genie_replicates.tsv")
grep_results = grep_analysis(regions, replicates)
grep_summary_plot(grep_results[[1]])
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.