offTargetAnalysisWithBulge: offTarget Analysis With Bulges Allowed Finding offtargets...

In LihuaJulieZhu/GUIDEseq: GUIDE-seq and PEtag-seq analysis pipeline

offTarget Analysis With Bulges Allowed Finding offtargets around peaks from GUIDE-seq or around any given genomic regions with bulges allowed in gRNA or the DNA sequence of offTargets when aligning gRNA and DNA sequences.

Description

offTarget Analysis With Bulges Allowed Finding offtargets around peaks from GUIDE-seq or around any given genomic regions with bulges allowed in gRNA or the DNA sequence of offTargets when aligning gRNA and DNA sequences.

Usage

offTargetAnalysisWithBulge(
  gRNA,
  gRNA.name,
  peaks,
  BSgenomeName,
  mat,
  peaks.withHeader = FALSE,
  peaks.format = "bed",
  gapOpening = 1L,
  gapExtension = 3L,
  max.DNA.bulge = 2L,
  max.mismatch = 10L,
  allowed.mismatch.PAM = 2L,
  upstream = 20L,
  downstream = 20L,
  PAM.size = 3L,
  gRNA.size = 20L,
  PAM = "NGG",
  PAM.pattern = "NNN$",
  PAM.location = "3prime",
  mismatch.activity.file = system.file("extdata",
    "NatureBiot2016SuppTable19DoenchRoot.xlsx", package = "GUIDEseq")
)

Arguments

gRNA	a character string containing the gRNA sequence without PAM
gRNA.name	name of the gRNA
peaks	peak input file path or a GenomicRanges object that contains genomic regions to be searched for potential offtargets
BSgenomeName	BSgenome object. Please refer to available.genomes in BSgenome package. For example, BSgenome.Hsapiens.UCSC.hg19 for hg19, BSgenome.Mmusculus.UCSC.mm10 for mm10, BSgenome.Celegans.UCSC.ce6 for ce6, BSgenome.Rnorvegicus.UCSC.rn5 for rn5, BSgenome.Drerio.UCSC.danRer7 for Zv9, and BSgenome.Dmelanogaster.UCSC.dm3 for dm3
mat	nucleotideSubstitutionMatrix, which can be created using nucleotideSubstitutionMatrix.
peaks.withHeader	Indicate whether the peak input file contains header, default FALSE
peaks.format	format of the peak file, default to bed file format. Currently, only bed format is supported
gapOpening	Gap opening penalty, default to 1L
gapExtension	Gap extension penalty, default to 3L
max.DNA.bulge	Total number of bulges allowed, including bulges in DNA and gRNA, default to 2L
max.mismatch	Maximum mismatch allowed in off target search, default 10L
allowed.mismatch.PAM	Number of degenerative bases in the PAM.pattern sequence, default to 2L
upstream	upstream offset from the peak start to search for off targets, default 20
downstream	downstream offset from the peak end to search for off targets, default 20
PAM.size	PAM length, default 3
gRNA.size	The size of the gRNA, default 20
PAM	PAM sequence after the gRNA, default NGG
PAM.pattern	Regular expression of protospacer-adjacent motif (PAM), default to any NNN$. Currently, only support NNN$
PAM.location	PAM location relative to gRNA. For example, default to 3prime for spCas9 PAM. Please set to 5prime for cpf1 PAM since it's PAM is located on the 5 prime end
mismatch.activity.file	Applicable only when scoring.method is set to CFDscore A comma separated (csv) file containing the cleavage rates for all possible types of single nucleotide mismatch at each position of the gRNA. By default, using the supplemental Table 19 from Doench et al., Nature Biotechnology 2016

Author(s)

Lihua Julie Zhu

Examples

if (interactive()) {
  library(GUIDEseq)
  peaks <- system.file("extdata","1450-chr14-chr2-bulge-test.bed", package = "GUIDEseq")
  mismatch.activity.file <-system.file("extdata", "NatureBiot2016SuppTable19DoenchRoot.xlsx",
    package = "GUIDEseq")

  gRNA <- "TGCTTGGTCGGCACTGATAG"
  gRNA.name <- "Test1450"
  library(BSgenome.Hsapiens.UCSC.hg38)

  temp <- offTargetAnalysisWithBulge(gRNA = gRNA, gRNA.name = gRNA.name,
     peaks = peaks, BSgenomeName = Hsapiens,
     mismatch.activity.file = mismatch.activity.file)
}

LihuaJulieZhu/GUIDEseq documentation built on March 27, 2024, 9:42 p.m.