TAPseqInput: Create TAPseq input from target sequences

In argschwind/TAPseq: Targeted scRNA-seq primer design for TAP-seq

Create TAPseq input from target sequences

Description

This function creates input for TAP-seq primer design from a DNAStringSet containing the target sequences (typically transcript sequences).

Usage

TAPseqInput(
  target_sequences,
  product_size_range,
  beads_oligo = NA,
  reverse_primer = "CTACACGACGCTCTTCCGATCT",
  target_annot = NULL,
  primer_num_return = 5,
  min_primer_region = 100,
  primer_opt_tm = 63,
  primer_min_tm = 59,
  primer_max_tm = 66
)

Arguments

target_sequences	A named DNAStringSet object containing all target sequences.
product_size_range	Numerical vector of length 2 specifying the desired length of the resulting amplicons.
beads_oligo	Beads-oligo-dT sequence for the used droplet sequencing protocol (10x, Drop-seq). If nothing is specified (beads_oligo = NA), the 10x V3 Beads-oligo-dT sequence is used. Can be changed if primers are for instance designed for Drop-seq. Any barcode bases need to be replaced by N.
reverse_primer	Reverse primer sequence used for all PCR reactions. Default is the 10x primer sequence: CTACACGACGCTCTTCCGATCT.
target_annot	(optional) A named GRangesList object with transcript annotations in case the targets are transcripts of gene loci. If provided, each GRanges within the list should contain all exons of one targeted transcripts. Names need to be the same as for target_sequences.
primer_num_return	How many forward primers should be designed? (default: 5)
min_primer_region	Minimum sequence length required for primer design. Mostly relevant in case a sequence template is too short to allow the specified product_size_range.
primer_opt_tm, primer_min_tm, primer_max_tm	Optimal, minumum and maximum primer melting temperature. Set to NA to use Primer3s default values.

Value

TsIOList object.

Examples

# chromosome 11 truncated transcript sequences and annotations
data("chr11_truncated_txs_seq")

# create TsIOList object for primer design from target sequences
obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500))
obj

# transcript annotations can be added for optional genome browser tracks of designed primers
data("chr11_truncated_txs")
obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500),
                   target_annot = chr11_truncated_txs)

# create input for primer design with Drop-seq instead of default 10x
ds_oligo <- "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"
ds_rev_primer <- "AAGCAGTGGTATCAACGCAGAGT"
ds_obj <- TAPseqInput(chr11_truncated_txs_seq, beads_oligo = ds_oligo,
                      reverse_primer = ds_rev_primer, product_size_range = c(350, 500),
                      primer_opt_tm = 62, primer_min_tm = 57, primer_max_tm = 65)

argschwind/TAPseq documentation built on Feb. 9, 2024, 8:20 p.m.